LXL04_022917 | RubberDandelionOmics

Gene overview

LXL04_022917

Reference: OH-1004 Chr: Chr05 Coordinates: 13586090-13587367 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1278 bp · LXL04_022917|LXL04_022917|OH1004|cDNA

ATGGAGTTCTTCTGCAACTCCTTTCTGCAACTACTTGCACTCTTTCTTACACTTCTCCTCACAATTTCTCCTACAACCCAACAACAACTAGCCGCCGTCGATCTCAATGCGCTCCATCAGATCATGGACACACTCACCGACGTAAAAAATGGCGGATTCTTCTCAACTTGGAACTTCTCCTCATCGGAAAATCCGTGTTCTTCGTTTGCCGGCGTCACTTGCTCTGTAATCAACGGTGAGTTACGAGTCACGGCTCTCTT...

CDS

Download CDS FASTA

1278 bp · LXL04_022917|LXL04_022917|OH1004|CDS

ATGGAGTTCTTCTGCAACTCCTTTCTGCAACTACTTGCACTCTTTCTTACACTTCTCCTCACAATTTCTCCTACAACCCAACAACAACTAGCCGCCGTCGATCTCAATGCGCTCCATCAGATCATGGACACACTCACCGACGTAAAAAATGGCGGATTCTTCTCAACTTGGAACTTCTCCTCATCGGAAAATCCGTGTTCTTCGTTTGCCGGCGTCACTTGCTCTGTAATCAACGGTGAGTTACGAGTCACGGCTCTCTT...

Protein

Download Protein FASTA

425 aa · LXL04_022917|LXL04_022917|OH1004|PROTEIN

MEFFCNSFLQLLALFLTLLLTISPTTQQQLAAVDLNALHQIMDTLTDVKNGGFFSTWNFSSSENPCSSFAGVTCSVINGELRVTALLLGTGMSDSPGLAGTISAVGIYDLTELTQLILYPGIVTGFIPSQLGRRLKNLRVISLTDNRLTGTIPQTISELQNLHTLDLSHNKLTGVIPPTLASALPELKVLVLAYNNLDGEIPEFTDESTLIHLDLRNNLLSGNLPDTLPATLRYLSLSSNGLWGPLNSVPSSNLVYLDLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022917`
TK1151 ID	TkA06G428000
OH-1004 ID	LXL04_022917
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022917

Location Chr05:13586090-13587367 (+)

Description Similar to DRT100: DNA damage-repair/toleration protein DRT100

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12610`	This protein is able to complement bacterial recA mutations, but its native function in the plant is not known.	No verified direct reference in this release
`At3g51740`	Probably inactive leucine-rich repeat receptor-like protein kinase IMK2.	No verified direct reference in this release
`At4g20140`	Together with GSO2, receptor-like serine/threonine-kinase required during the development of the epidermal surface in embryos and cotyledons.	GASSHO1 and GASSHO2 encoding a putative leucine-rich repeat transmembrane-type receptor kinase are essential for the normal development of the epidermal surface in Arabidopsis embryos.2008 · DOI: 10.1111/j.1365-313x.2007.03395.x The receptor-like kinases GSO1 and GSO2 together regulate root growth in Arabidopsis through control of cell division and cell fate specification.2014 · DOI: 10.1002/dvdy.24066 A peptide hormone required for Casparian strip diffusion barrier formation in Arabidopsis roots.2017 · DOI: 10.1126/science.aai9057
`At3g56100`	Can phosphorylate AGL24.	No verified direct reference in this release
`At5g49660`	Receptor kinase involved in the perception of C-terminally encoded plant signaling peptide (CEP) and subsequent regulation of root and shoot development.	XYLEM INTERMIXED WITH PHLOEM1, a leucine-rich repeat receptor-like kinase required for stem growth and vascular development in Arabidopsis thaliana.2012 · DOI: 10.1007/s00425-011-1489-6 CEP5 and XIP1/CEPR1 regulate lateral root initiation in Arabidopsis.2016 · DOI: 10.1093/jxb/erw231

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022917 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0007165 signal transduction Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0004672 protein kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT3G12610

ath:AT3G51740

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.483

Rank 1 · LXL04_022917 · OH-1004

Extracellular0.190

Rank 2 · LXL04_022917 · OH-1004

Endoplasmic reticulum0.126

Rank 3 · LXL04_022917 · OH-1004

Cytoplasm0.091

Rank 4 · LXL04_022917 · OH-1004

Nucleus0.056

Rank 5 · LXL04_022917 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_234-75 aa

PF13855.13LRR_8129-172 aa

PF12799.14LRR_4136-172 aa

PF13855.13LRR_8137-197 aa

PF12799.14LRR_4160-201 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022917	`PF08263.18`	LRRNT_2	34	75	2.2e-07	31.8
LXL04_022917	`PF13855.13`	LRR_8	129	172	2.3e-19	69.6
LXL04_022917	`PF12799.14`	LRR_4	136	172	2e-17	63.5
LXL04_022917	`PF13855.13`	LRR_8	137	197	2.3e-19	69.6
LXL04_022917	`PF12799.14`	LRR_4	160	201	2e-17	63.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q00874`	Arabidopsis thaliana	DNA damage-repair/toleration protein DRT100	35.152%	Swiss-Prot	moderate database homology
`Q9SCT4`	Arabidopsis thaliana	Probably inactive leucine-rich repeat receptor-like protein kinase IMK2	33.714%	Swiss-Prot	moderate database homology
`C0LGQ5`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase GSO1	38.525%	Swiss-Prot	moderate database homology
`C0LGP9`	Arabidopsis thaliana	Probable leucine-rich repeat receptor-like protein kinase IMK3	34.561%	Swiss-Prot	moderate database homology
`Q9FGL5`	Arabidopsis thaliana	Receptor protein-tyrosine kinase CEPR1	36.996%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card