TkAUNG090180 | RubberDandelionOmics

Gene overview

TkAUNG090180

Reference: TK1151 Chr: ChrUn Coordinates: 25604021-25605336 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1177 bp · TkAUNG090180|TK1151|cDNA

TTATTCTTTAAGGCAGGAAGTGAAGAACATCCCCATTTTATCTACAATGGAGTTGCTCTCCTTCTCGACTCCCTCGTCTTACTGCCCTCCTTCATCCATCTCCAATCTCCGTCAGCTTCTTCCAACAAAACCCTCCCAATCCCTTTCTCTCCGCCGCCTAGCACCACCGCAAAGCTCCGTCAGATGTTCAGTTGGGTCCTCTCTCCAAACCCTAGGATTTGACTTCAAACCAACACTCGGTTTCTCGGCTTCTTCGCCAC...

CDS

Download CDS FASTA

894 bp · TkAUNG090180|TK1151|CDS

ATGGAGTTGCTCTCCTTCTCGACTCCCTCGTCTTACTGCCCTCCTTCATCCATCTCCAATCTCCGTCAGCTTCTTCCAACAAAACCCTCCCAATCCCTTTCTCTCCGCCGCCTAGCACCACCGCAAAGCTCCGTCAGATGTTCAGTTGGGTCCTCTCTCCAAACCCTAGGATTTGACTTCAAACCAACACTCGGTTTCTCGGCTTCTTCGCCACAGACTCCGGCGACAGCGATGAGAGGCGCCGAATCCGACGCGATGGG...

Protein

Download Protein FASTA

297 aa · TkAUNG090180|TK1151|PROTEIN

MELLSFSTPSSYCPPSSISNLRQLLPTKPSQSLSLRRLAPPQSSVRCSVGSSLQTLGFDFKPTLGFSASSPQTPATAMRGAESDAMGLLLRERIVFLGTQIDDFVADAIISQLLLLDAQDPSKDIRLFVNSTGGSLSASMAIYDVLKLVRADVSTIALGISASTASIILGGGTKGKRLAMPNTRIMIHQPMGGASGQAIDVEIQAREMMHNKDNVTRILAESTGRSYEQVQKDIDRDRYMSPIEAVEYGIIDGVIDEDSI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG090180`
TK1151 ID	TkAUNG090180
OH-1004 ID	LXL04_026028
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 33.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG090180

Location ChrUn:25604021-25605336 (-)

Description Similar to CASC125: (E)-beta-farnesene synthase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g45390`	Cleaves peptides in various proteins in a process that requires ATP hydrolysis.	A nuclear-encoded ClpP subunit of the chloroplast ATP-dependent Clp protease is essential for early development in Arabidopsis thaliana.2006 · DOI: 10.1007/s00425-006-0292-2 The chloroplast protease subunit ClpP4 is a substrate of the E3 ligase AtCHIP and plays an important role in chloroplast function.2007 · DOI: 10.1111/j.1365-313x.2006.02963.x Modified Clp protease complex in the ClpP3 null mutant and consequences for chloroplast development and function in Arabidopsis.2013 · DOI: 10.1104/pp.113.215699

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026028 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016102 diterpenoid biosynthetic process Biological Process

GO:0046246 terpene biosynthetic process Biological Process

GO:0051762 sesquiterpene biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0010333 terpene synthase activity Molecular Function

GO:0034005 germacrene-A synthase activity Molecular Function

GO:0080016 (-)-E-beta-caryophyllene synthase activity Molecular Function

KEGG gene cross-reference

ag:AAL79181

ag:AMP42991

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.974

Rank 1 · TkAUNG090180 · TK1151

Mitochondrion0.032

Rank 2 · TkAUNG090180 · TK1151

Nucleus0.022

Rank 3 · TkAUNG090180 · TK1151

Cytoplasm0.015

Rank 4 · TkAUNG090180 · TK1151

Cell membrane0.013

Rank 5 · TkAUNG090180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00574CLP_protease83-257 aa

PF19575HTH_58212-231 aa

PF19575HTH_58248-258 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG090180	`PF00574`	CLP_protease	83	257	1.3e-71	241.0
TkAUNG090180	`PF19575`	HTH_58	212	231	0.21	12.2
TkAUNG090180	`PF19575`	HTH_58	248	258	0.21	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94B60`	Arabidopsis thaliana	sp\|Q94B60\|CLPP4_ARATH ATP-dependent Clp protease proteolytic subunit 4, chloroplastic	81.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card