TkA08G434420 | RubberDandelionOmics

Gene overview

TkA08G434420

Reference: TK1151 Chr: Chr08 Coordinates: 110408397-110411153 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1302 bp · TkA08G434420|TK1151|cDNA

GTTTACCATAGTCATGGATATCTAATGAGACTTTCAACCAACAACCGGCCTGGCTTGGCCGAGTACGGTTAGGAGATTTTGCCGACTTTGGCCATTTGTATGATCTCTCTCATCATACGAAGTGGGTCCCTTCTATCACATCAATAATCGGTGTTCCCAATGGCTTCCTCTAGAGGAGTTGTATTACTACTGCAACCGATAAATTCACGACAAAACAAACAACTTTCGAACAACAACAATGGAGAAATCCAAGATTGGGA...

CDS

Download CDS FASTA

768 bp · TkA08G434420|TK1151|CDS

ATGGAGAAATCCAAGATTGGGAGAAGATTTGAAGGAAAAGTTGCGATTGTTACAGCCTCAACTCAAGGCATAGGTTTCGCTATTGCTCAACGGATCGGCTTAGAAGGCGGATCAGTCGTCATCTCCTCTCGCAAACAGAAAAACGTTGATGAGGCAGTGAAAAAGCTCAAGGATTCTGGAATCGAAGTGTTGGGATTGGTATGCCATGTTTCTAATGCACAACAGAGAAAGAATCTCATTGACCAGACAGTTGAGAAATA...

Protein

Download Protein FASTA

255 aa · TkA08G434420|TK1151|PROTEIN

MEKSKIGRRFEGKVAIVTASTQGIGFAIAQRIGLEGGSVVISSRKQKNVDEAVKKLKDSGIEVLGLVCHVSNAQQRKNLIDQTVEKYGKIDVVVSNAAANPSVNTILKTQESALDKLWEINVKTSILLLKDASPHLAEGSSVVFISSVTAFQPPAGLAMYGVTKTALLGLTKALASEMAPRTRVNCVAPGFVPTHFAGFITSNEAMRKSLEEQTCLKRLGTTEDMAAATAFLASDDASYITGETIVVAGGMPSRL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G434420`
TK1151 ID	TkA08G434420
OH-1004 ID	LXL04_034763
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G434420

Location Chr08:110408397-110411153 (-)

Description Similar to Tropinone reductase-like 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g05530`	Involved with IBR3 and IBR10 in the peroxisomal beta- oxidation of indole-3-butyric acid (IBA) to form indole-3-acetic acid (IAA), a biologically active auxin.	Identification of two Arabidopsis genes encoding a peroxisomal oxidoreductase-like protein and an acyl-CoA synthetase-like protein that are required for responses to pro-auxins.2009 · DOI: 10.1007/s11103-008-9431-4 Conversion of endogenous indole-3-butyric acid to indole-3-acetic acid drives cell expansion in Arabidopsis seedlings.2010 · DOI: 10.1104/pp.110.157461

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034763 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001523 retinoid metabolic process Biological Process

GO:0006066 alcohol metabolic process Biological Process

GO:0006631 fatty acid metabolic process Biological Process

GO:0008202 steroid metabolic process Biological Process

GO:0042180 ketone metabolic process Biological Process

GO:0042574 retinal metabolic process Biological Process

GO:0048767 root hair elongation Biological Process

GO:0080024 indolebutyric acid metabolic process Biological Process

GO:0080026 response to indolebutyric acid Biological Process

GO:2000379 positive regulation of reactive oxygen species metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT4G05530

hsa:10901

pon:100172190

ssc:397082

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.475

Rank 1 · TkA08G434420 · TK1151

Peroxisome0.323

Rank 2 · TkA08G434420 · TK1151

Mitochondrion0.175

Rank 3 · TkA08G434420 · TK1151

Nucleus0.150

Rank 4 · TkA08G434420 · TK1151

Plastid0.085

Rank 5 · TkA08G434420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short13-203 aa

PF13684FakA-like_C14-96 aa

PF23441SDR16-250 aa

PF08659KR16-184 aa

PF13561adh_short_C219-251 aa

PF09667DUF202840-144 aa

PF21787TNP-like_RNaseH_N42-69 aa

PF00331Glyco_hydro_1044-94 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G434420	`PF00106`	adh_short	13	203	5.1e-42	144.3
TkA08G434420	`PF13684`	FakA-like_C	14	96	0.053	13.6
TkA08G434420	`PF23441`	SDR	16	250	7.3e-12	45.9
TkA08G434420	`PF08659`	KR	16	184	1.3e-10	42.2
TkA08G434420	`PF13561`	adh_short_C2	19	251	5.7e-59	200.3
TkA08G434420	`PF09667`	DUF2028	40	144	0.11	13.2
TkA08G434420	`PF21787`	TNP-like_RNaseH_N	42	69	0.11	13.5
TkA08G434420	`PF00331`	Glyco_hydro_10	44	94	0.077	12.9
TkA08G434420	`PF26334`	Gtf3_N	46	95	0.066	13.7
TkA08G434420	`PF19411`	Clink	70	110	0.22	12.3
TkA08G434420	`PF21787`	TNP-like_RNaseH_N	71	96	0.11	13.5
TkA08G434420	`PF13684`	FakA-like_C	86	113	0.053	13.6
TkA08G434420	`PF26334`	Gtf3_N	196	217	0.066	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S9W2`	Arabidopsis thaliana	sp\|Q9S9W2\|SDRA_ARATH Short-chain dehydrogenase/reductase SDRA	72.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card