RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G379360
Reference: TK1151 Chr: Chr07 Coordinates: 95068725-95071636 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1439 bp · TkA07G379360|TK1151|cDNA

CCCTTTCCCACTAGTCTATCTTTATTGTTAGTTTAGTGGATTAAATTATGTGTCTATAAAAACCCGAAAAATTTCCATTTCTAATGTTCTTCAAGATTTTGCCTTCTCCATTTGCTCAAGATTTTGCATGCACACACATATGACACCAACATCGACTCACATTTCCACTACAACAAGAATGGGGACATATGATCCACTTCACCATATTCATATGCCGGACAACATATTCGAAGATCATATGAGCACGAAGACGAACCGTG...

CDS

Download CDS FASTA

1095 bp · TkA07G379360|TK1151|CDS

ATGCACACACATATGACACCAACATCGACTCACATTTCCACTACAACAAGAATGGGGACATATGATCCACTTCACCATATTCATATGCCGGACAACATATTCGAAGATCATATGAGCACGAAGACGAACCGTGACGTAATCACGCAATCCGAATCAAGGCTAACTAACAATATCTTGTACACTTCTCAAGAATCATTAGAATCTTCTCGGGATTCGGATAAGAATATCTCAGATAAGTTTCAAAGACGACTAGCACAAAA...

Protein

Download Protein FASTA

364 aa · TkA07G379360|TK1151|PROTEIN

MHTHMTPTSTHISTTTRMGTYDPLHHIHMPDNIFEDHMSTKTNRDVITQSESRLTNNILYTSQESLESSRDSDKNISDKFQRRLAQNREAARKSRLKRKAYVQELESGRLKLAKLEHEIERTRQQGAYVDSPNTDYGQLSGIAKFVAKYDIWVAEQQKKESELMTILQTDVSDDELRVVIDGVVDHYQYLFRMKADAAKVDAFSLLYGSWWPPIERLFQWLGGFRPSEVLYILMPWFDPLTDTQIVNLSKLRHTCRQAED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G379360
TK1151 IDTkA07G379360
OH-1004 IDLXL04_031192
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)57.300
Protein coverage (%)TK1151 95.879 / OH-1004 98.077
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G379360
LocationChr07:95068725-95071636 (+)
DescriptionSimilar to TGA1: Transcription factor TGA1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g22070 Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.
Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to a defense gene promoter in Arabidopsis.2003 · DOI: 10.1105/tpc.012211
At1g77920 Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'. No verified direct reference in this release
At5g10030 Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'. No verified direct reference in this release
At5g65210 Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0637000 Transcriptional regulator involved in defense response. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_031192 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0009626 plant-type hypersensitive response Biological Process
GO:0009862 systemic acquired resistance, salicylic acid mediated signaling pathway Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0005634 nucleus Cellular Component
GO:0000976 transcription cis-regulatory region binding Molecular Function
GO:0003677 DNA binding Molecular Function
GO:0003700 DNA-binding transcription factor activity Molecular Function
GO:0005516 calmodulin binding Molecular Function
GO:0043565 sequence-specific DNA binding Molecular Function
KEGG gene cross-reference
ath:AT1G22070
ath:AT1G77920
ath:AT5G10030
ath:AT5G65210
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.607
Rank 1 · TkA07G379360 · TK1151
Cytoplasm0.384
Rank 2 · TkA07G379360 · TK1151
Cell membrane0.058
Rank 3 · TkA07G379360 · TK1151
Mitochondrion0.043
Rank 4 · TkA07G379360 · TK1151
Endoplasmic reticulum0.036
Rank 5 · TkA07G379360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16064DUF480664-90 aa
PF00170bZIP_178-112 aa
PF07716bZIP_279-115 aa
PF03131bZIP_Maf79-136 aa
PF16064DUF4806112-124 aa
PF14144DOG1161-234 aa
PF03131bZIP_Maf249-256 aa
PF07716bZIP_2259-271 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G379360PF16064DUF480664900.3511.9
TkA07G379360PF00170bZIP_1781122e-0731.7
TkA07G379360PF07716bZIP_2791159.7e-0523.1
TkA07G379360PF03131bZIP_Maf791360.02815.7
TkA07G379360PF16064DUF48061121240.3511.9
TkA07G379360PF14144DOG11612347.3e-2381.3
TkA07G379360PF03131bZIP_Maf2492560.02815.7
TkA07G379360PF07716bZIP_22592719.7e-0523.1
TkA07G379360PF16064DUF48062612740.3511.9
TkA07G379360PF16064DUF48062923270.3511.9
TkA07G379360PF00170bZIP_13143302e-0731.7
TkA07G379360PF03131bZIP_Maf3143290.02815.7
TkA07G379360PF07716bZIP_23213309.7e-0523.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q39234Arabidopsis thalianasp|Q39234|TGA3_ARATH Transcription factor TGA350.400%Swiss-ProtHigh
Q93ZE2Arabidopsis thalianasp|Q93ZE2|TGA7_ARATH Transcription factor TGA749.900%Swiss-ProtMedium
Q39162Arabidopsis thalianasp|Q39162|TGA4_ARATH Transcription factor TGA448.900%Swiss-ProtMedium
Q39237Arabidopsis thalianasp|Q39237|TGA1_ARATH Transcription factor TGA148.100%Swiss-ProtMedium
A0A0P0WFC8Oryza sativa subsp. japonicasp|A0A0P0WFC8|TGAL6_ORYSJ Transcription factor TGAL646.100%Swiss-ProtMedium

JBrowse

View in Genome Browser