TkA07G048400 | RubberDandelionOmics

Gene overview

TkA07G048400

Reference: TK1151 Chr: Chr07 Coordinates: 12850886-12855597 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3083 bp · TkA07G048400|TK1151|cDNA

TTCCACATCAACTTTCATTCGCTATAAATTCATCATTACACGCTTTCTAATCAATGCAATCCCAAAAAATGCCTTCTTTTTCCCCTTCGAAGTTCATTCTCCTCTTCATCGTATCTATAATTCTGTCAAACGGTTCAGTGGCAGTGGCCCAAAACCGGACCACAAACATAGGAGTCATCATCGATGAAAGTACCCGAGTAGGAAAAGAACAAAAGACCGCCATTGAAATTGCTGTCCAGAAGCTCAATTCAGGCTCCAAA...

CDS

Download CDS FASTA

2787 bp · TkA07G048400|TK1151|CDS

ATGCAATCCCAAAAAATGCCTTCTTTTTCCCCTTCGAAGTTCATTCTCCTCTTCATCGTATCTATAATTCTGTCAAACGGTTCAGTGGCAGTGGCCCAAAACCGGACCACAAACATAGGAGTCATCATCGATGAAAGTACCCGAGTAGGAAAAGAACAAAAGACCGCCATTGAAATTGCTGTCCAGAAGCTCAATTCAGGCTCCAAAGATGACTTGTTGGCTATTCATTTCAGGAACTCTAGTGGAGACCCTCTCGAAGC...

Protein

Download Protein FASTA

928 aa · TkA07G048400|TK1151|PROTEIN

MQSQKMPSFSPSKFILLFIVSIILSNGSVAVAQNRTTNIGVIIDESTRVGKEQKTAIEIAVQKLNSGSKDDLLAIHFRNSSGDPLEAASSANELIEKQNVRVIIGTNSWEETTIVAKIGQQARVPVISSNTARLQPLSHLQWPFLVQMTDLDISNEIKCITSLVKSYNWKRVIAVYEDNVYGGEYEGFSILSEALQKIGSVIEHRLVVPHFTSPFDPKETIRDNLATVLTTKQSRVFILLKSSLPTATRVFEEAKKLGLT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G048400`
TK1151 ID	TkA07G048400
OH-1004 ID	LXL04_027309
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G048400

Location Chr07:12850886-12855597 (-)

Description Similar to GLR2.7: Glutamate receptor 2.7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g29120`	Glutamate-gated receptor that probably acts as a non-selective cation channel.	No verified direct reference in this release
`At2g29100`	Glutamate-gated receptor that probably acts as a non-selective cation channel.	No verified direct reference in this release
`At2g29110`	Glutamate-gated receptor that probably acts as a non-selective cation channel.	No verified direct reference in this release
`At2g32390`	Glutamate-gated receptor that probably acts as a non-selective cation channel.	No verified direct reference in this release
`At1g05200`	Glutamate-gated receptor that probably acts as a non-selective cation channel, at least in hypocotyls (Probable).	AtGLR3.4, a glutamate receptor channel-like gene is sensitive to touch and cold.2005 · DOI: 10.1007/s00425-005-1551-3 Glutamate receptor subtypes evidenced by differences in desensitization and dependence on the GLR3.3 and GLR3.4 genes.2008 · DOI: 10.1104/pp.107.108134 Dual localization of plant glutamate receptor AtGLR3.4 to plastids and plasmamembrane.2011 · DOI: 10.1016/j.bbabio.2010.11.008 Interacting glutamate receptor-like proteins in Phloem regulate lateral root initiation in Arabidopsis.2013 · DOI: 10.1105/tpc.113.110668 Glutamate Receptor Homolog3.4 is Involved in Regulation of Seed Germination Under Salt Stress in Arabidopsis.2018 · DOI: 10.1093/pcp/pcy034

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027309 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006816 calcium ion transport Biological Process

GO:0006874 intracellular calcium ion homeostasis Biological Process

GO:0006883 intracellular sodium ion homeostasis Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009611 response to wounding Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0030007 intracellular potassium ion homeostasis Biological Process

GO:0070417 cellular response to cold Biological Process

GO:0071230 cellular response to amino acid stimulus Biological Process

GO:0071260 cellular response to mechanical stimulus Biological Process

GO:0071311 cellular response to acetate Biological Process

GO:1901701 cellular response to oxygen-containing compound Biological Process

KEGG gene cross-reference

ath:AT1G05200

ath:AT2G29100

ath:AT2G29110

ath:AT2G29120

ath:AT4G35290

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.822

Rank 1 · TkA07G048400 · TK1151

Endoplasmic reticulum0.076

Rank 2 · TkA07G048400 · TK1151

Cytoplasm0.071

Rank 3 · TkA07G048400 · TK1151

Lysosome / Vacuole0.044

Rank 4 · TkA07G048400 · TK1151

Nucleus0.031

Rank 5 · TkA07G048400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13458Peripla_BP_638-352 aa

PF13433Peripla_BP_549-106 aa

PF01094ANF_receptor54-389 aa

PF04392ABC_sub_bind66-129 aa

PF10613Lig_chan-Glu_bd159-184 aa

PF24576IR75A_N212-268 aa

PF13433Peripla_BP_5248-248 aa

PF01094ANF_receptor442-475 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G048400	`PF13458`	Peripla_BP_6	38	352	5.7e-13	49.9
TkA07G048400	`PF13433`	Peripla_BP_5	49	106	0.13	12.1
TkA07G048400	`PF01094`	ANF_receptor	54	389	2.2e-41	142.8
TkA07G048400	`PF04392`	ABC_sub_bind	66	129	0.08	12.9
TkA07G048400	`PF10613`	Lig_chan-Glu_bd	159	184	3e-10	40.9
TkA07G048400	`PF24576`	IR75A_N	212	268	0.0053	17.0
TkA07G048400	`PF13433`	Peripla_BP_5	248	248	0.13	12.1
TkA07G048400	`PF01094`	ANF_receptor	442	475	2.2e-41	142.8
TkA07G048400	`PF10613`	Lig_chan-Glu_bd	465	551	3e-10	40.9
TkA07G048400	`PF00497`	SBP_bac_3	468	784	2.1e-09	38.0
TkA07G048400	`PF03916`	NrfD	546	657	0.18	12.1
TkA07G048400	`PF00060`	Lig_chan	568	815	2.6e-31	109.1
TkA07G048400	`PF24576`	IR75A_N	588	624	0.0053	17.0
TkA07G048400	`PF03916`	NrfD	809	832	0.18	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LGN0`	Arabidopsis thaliana	sp\|Q8LGN0\|GLR27_ARATH Glutamate receptor 2.7	33.100%	Swiss-Prot	Medium
`O81078`	Arabidopsis thaliana	sp\|O81078\|GLR29_ARATH Glutamate receptor 2.9	34.800%	Swiss-Prot	Medium
`Q9C5V5`	Arabidopsis thaliana	sp\|Q9C5V5\|GLR28_ARATH Glutamate receptor 2.8	32.800%	Swiss-Prot	Medium
`Q9SW97`	Arabidopsis thaliana	sp\|Q9SW97\|GLR35_ARATH Glutamate receptor 3.5	31.300%	Swiss-Prot	Medium
`Q8GXJ4`	Arabidopsis thaliana	sp\|Q8GXJ4\|GLR34_ARATH Glutamate receptor 3.4	31.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card