RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_027309
Reference: OH-1004 Chr: Chr06 Coordinates: 13121574-13125937 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2787 bp · LXL04_027309|LXL04_027309|OH1004|cDNA

ATGCAATCCCAAAAAATGCCTTATTTTTCCCCTTCAAAGTTCATTCTCCTCTTCATCGTATCTATAATTCTGTCAAACGGTTCAGTGGCAGTGGCCCAAAACCGGACCACAAACATAGGAGTCATCATCGATGAAAGTACCCGAGTAGGAAAAGAACAAAAGACCGCCATTGAAATTGCTGTCCAGAAGCTCAATTCAGGCTCCAAAGATGACGTGTTGGCTATTCATTTCAGGAACTCTAGTGGAGACCCTCTCGAAGC...

CDS

Download CDS FASTA

2787 bp · LXL04_027309|LXL04_027309|OH1004|CDS

ATGCAATCCCAAAAAATGCCTTATTTTTCCCCTTCAAAGTTCATTCTCCTCTTCATCGTATCTATAATTCTGTCAAACGGTTCAGTGGCAGTGGCCCAAAACCGGACCACAAACATAGGAGTCATCATCGATGAAAGTACCCGAGTAGGAAAAGAACAAAAGACCGCCATTGAAATTGCTGTCCAGAAGCTCAATTCAGGCTCCAAAGATGACGTGTTGGCTATTCATTTCAGGAACTCTAGTGGAGACCCTCTCGAAGC...

Protein

Download Protein FASTA

928 aa · LXL04_027309|LXL04_027309|OH1004|PROTEIN

MQSQKMPYFSPSKFILLFIVSIILSNGSVAVAQNRTTNIGVIIDESTRVGKEQKTAIEIAVQKLNSGSKDDVLAIHFRNSSGDPLEAASSANELIEKQNVRVIIGTNSWEETTVVAKIGQQARVPVISSNTARLQPLSHLQWPFLVQMTDLDISNEIKCITSLVKSYNWKRVIAVYEDNVYGGEYEGFSILSEALQNIDSVIEHRLVVPHFTSPFDPKETIRDNLATVLTTKQSRVFILLKSSLPTATRVFEEAKKLGLT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_027309
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_027309
LocationChr06:13121574-13125937 (-)
DescriptionSimilar to GLR2.7: Glutamate receptor 2.7
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g29120 Glutamate-gated receptor that probably acts as a non-selective cation channel. No verified direct reference in this release
At2g29100 Glutamate-gated receptor that probably acts as a non-selective cation channel. No verified direct reference in this release
At2g29110 Glutamate-gated receptor that probably acts as a non-selective cation channel. No verified direct reference in this release
At1g05200 Glutamate-gated receptor that probably acts as a non-selective cation channel, at least in hypocotyls (Probable).
AtGLR3.4, a glutamate receptor channel-like gene is sensitive to touch and cold.2005 · DOI: 10.1007/s00425-005-1551-3
Glutamate receptor subtypes evidenced by differences in desensitization and dependence on the GLR3.3 and GLR3.4 genes.2008 · DOI: 10.1104/pp.107.108134
Dual localization of plant glutamate receptor AtGLR3.4 to plastids and plasmamembrane.2011 · DOI: 10.1016/j.bbabio.2010.11.008
Interacting glutamate receptor-like proteins in Phloem regulate lateral root initiation in Arabidopsis.2013 · DOI: 10.1105/tpc.113.110668
Glutamate Receptor Homolog3.4 is Involved in Regulation of Seed Germination Under Salt Stress in Arabidopsis.2018 · DOI: 10.1093/pcp/pcy034
At4g35290 Glutamate-gated receptor that probably acts as a non-selective cation channel (Probable).
Overexpression of the AtGluR2 gene encoding an Arabidopsis homolog of mammalian glutamate receptors impairs calcium utilization and sensitivity to ionic stress in transgenic plants.2001 · DOI: 10.1093/pcp/pce008
Interacting glutamate receptor-like proteins in Phloem regulate lateral root initiation in Arabidopsis.2013 · DOI: 10.1105/tpc.113.110668

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_027309 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006816 calcium ion transport Biological Process
GO:0006874 intracellular calcium ion homeostasis Biological Process
GO:0006883 intracellular sodium ion homeostasis Biological Process
GO:0009416 response to light stimulus Biological Process
GO:0009611 response to wounding Biological Process
GO:0019722 calcium-mediated signaling Biological Process
GO:0030007 intracellular potassium ion homeostasis Biological Process
GO:0070417 cellular response to cold Biological Process
GO:0071230 cellular response to amino acid stimulus Biological Process
GO:0071260 cellular response to mechanical stimulus Biological Process
GO:0071311 cellular response to acetate Biological Process
GO:1901701 cellular response to oxygen-containing compound Biological Process
KEGG gene cross-reference
ath:AT1G05200
ath:AT2G29100
ath:AT2G29110
ath:AT2G29120
ath:AT4G35290
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.822
Rank 1 · LXL04_027309 · OH-1004
Endoplasmic reticulum0.075
Rank 2 · LXL04_027309 · OH-1004
Cytoplasm0.072
Rank 3 · LXL04_027309 · OH-1004
Lysosome / Vacuole0.044
Rank 4 · LXL04_027309 · OH-1004
Nucleus0.031
Rank 5 · LXL04_027309 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13458.13Peripla_BP_638-378 aa
PF01094.35ANF_receptor54-389 aa
PF10613.15Lig_chan-Glu_bd465-551 aa
PF00497.26SBP_bac_3468-784 aa
PF00060.33Lig_chan568-815 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_027309PF13458.13Peripla_BP_6383781.6e-1351.8
LXL04_027309PF01094.35ANF_receptor543891.7e-41143.2
LXL04_027309PF10613.15Lig_chan-Glu_bd4655512.9e-1041.0
LXL04_027309PF00497.26SBP_bac_34687842.1e-0938.0
LXL04_027309PF00060.33Lig_chan5688152.8e-31109.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8LGN0Arabidopsis thalianaGlutamate receptor 2.732.579%Swiss-Protmoderate database homology
O81078Arabidopsis thalianaGlutamate receptor 2.934.579%Swiss-Protmoderate database homology
Q9C5V5Arabidopsis thalianaGlutamate receptor 2.832.558%Swiss-Protmoderate database homology
Q8GXJ4Arabidopsis thalianaGlutamate receptor 3.431.059%Swiss-Protmoderate database homology
Q93YT1Arabidopsis thalianaGlutamate receptor 3.231.031%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser