TkA07G036900 | RubberDandelionOmics

Gene overview

TkA07G036900

Reference: TK1151 Chr: Chr07 Coordinates: 9814235-9817262 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1750 bp · TkA07G036900|TK1151|cDNA

GATCTTTCCAATTTCTAAAAACTTAAACTGCAGATGTGTCTTTAAAACCCAATGGGTGTGACTATTAAAAGATCTATTCTTGCAAACTTTTTATACATAATATGCCTGATTATTTCATTAAAACTATGCAAGGCGGCTGATTTTCTGACTAAAGATAGTCCAATCTCATTACAACAGACACTAGTCTCTTTCAATCAAAATTTTGAGCTGGGCTTCTTCGTTCCAGGTAATTCCACTAACCGATATCTTGGTATATGGTT...

CDS

Download CDS FASTA

807 bp · TkA07G036900|TK1151|CDS

ATGGGGTTTTGTGGTGGCTTTTCAATGTGTACTAATAGGACTCGTATTTGTGAGTGCTTTAAAGGGTTTGTACCACAATCGAATGATGAATGGAGTAAAGGTAATTGGACAAGGGGTTGTGTGAGGGAAAATGAACTTTTATGTGAGAGGAATGAAAGTAGTACTTTAGCTTCTAGAAAAATTAAACCCGATAAGTTTGAAGTGGTAAAAAGGGTCAAGCTGCCGGATCATTATCAATACTTTCTATATATGGATACGGA...

Protein

Download Protein FASTA

268 aa · TkA07G036900|TK1151|PROTEIN

MGFCGGFSMCTNRTRICECFKGFVPQSNDEWSKGNWTRGCVRENELLCERNESSTLASRKIKPDKFEVVKRVKLPDHYQYFLYMDTDECQAWCLANCSCKAYAYVEGINCMVWEQDLIDIEQFSFGGENLLLRLAYEESDPKKRRQLDWSTRFNIIQGIGRGLIYLHRDSSLRIIHRDLKCSNILLDDKMNPKISDFGLARTFQMTQELANTRRIVGTYGYMSPEYAMRGVISEKSDVFSYGVMLLEIISGKGTPNLYIA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G036900`
TK1151 ID	TkA07G036900
OH-1004 ID	LXL04_027170
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	68.500
Protein coverage (%)	TK1151 53.358 / OH-1004 24.315 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G036900

Location Chr07:9814235-9817262 (-)

Description Similar to At1g61550: G-type lectin S-receptor-like serine/threonine-protein kinase At1g61550

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g61370`	G-type lectin S-receptor-like serine/threonine-protein kinase At1g61370.	No verified direct reference in this release
`At1g61550`	G-type lectin S-receptor-like serine/threonine-protein kinase At1g61550.	No verified direct reference in this release
`At1g61380`	S-domain receptor protein kinase involved in lipopolysaccharide (LPS) sensing.	A lectin S-domain receptor kinase mediates lipopolysaccharide sensing in Arabidopsis thaliana.2015 · DOI: 10.1038/ni.3124 Lipopolysaccharides Trigger Two Successive Bursts of Reactive Oxygen Species at Distinct Cellular Locations.2018 · DOI: 10.1104/pp.17.01637 Tyrosine phosphorylation of the lectin receptor-like kinase LORE regulates plant immunity.2020 · DOI: 10.15252/embj.2019102856
`At1g61420`	G-type lectin S-receptor-like serine/threonine-protein kinase At1g61420.	No verified direct reference in this release
`At1g61500`	G-type lectin S-receptor-like serine/threonine-protein kinase At1g61500.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027170 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006955 immune response Biological Process

GO:0007165 signal transduction Biological Process

GO:0045087 innate immune response Biological Process

GO:0048544 recognition of pollen Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G61370

ath:AT1G61390

ath:AT1G61440

ath:AT1G61480

ath:AT1G61550

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.611

Rank 1 · TkA07G036900 · TK1151

Endoplasmic reticulum0.121

Rank 2 · TkA07G036900 · TK1151

Cytoplasm0.109

Rank 3 · TkA07G036900 · TK1151

Extracellular0.070

Rank 4 · TkA07G036900 · TK1151

Nucleus0.054

Rank 5 · TkA07G036900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00954S_locus_glycop3-26 aa

PF00024PAN_18-20 aa

PF08276PAN_263-120 aa

PF00024PAN_167-115 aa

PF00954S_locus_glycop83-96 aa

PF14295PAN_485-106 aa

PF12330Haspin_kinase111-210 aa

PF07714PK_Tyr_Ser-Thr142-255 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G036900	`PF00954`	S_locus_glycop	3	26	0.023	16.0
TkA07G036900	`PF00024`	PAN_1	8	20	0.013	16.1
TkA07G036900	`PF08276`	PAN_2	63	120	1.6e-17	64.0
TkA07G036900	`PF00024`	PAN_1	67	115	0.013	16.1
TkA07G036900	`PF00954`	S_locus_glycop	83	96	0.023	16.0
TkA07G036900	`PF14295`	PAN_4	85	106	0.09	13.6
TkA07G036900	`PF12330`	Haspin_kinase	111	210	0.0078	16.0
TkA07G036900	`PF07714`	PK_Tyr_Ser-Thr	142	255	7.2e-25	88.5
TkA07G036900	`PF00069`	Pkinase	150	252	1.9e-26	93.7
TkA07G036900	`PF01636`	APH	169	212	0.062	13.8
TkA07G036900	`PF17667`	Pkinase_fungal	172	225	0.16	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64783`	Arabidopsis thaliana	sp\|O64783\|Y1137_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At1g61370	34.500%	Swiss-Prot	Medium
`Q9SY95`	Arabidopsis thaliana	sp\|Q9SY95\|Y1155_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At1g61550	35.300%	Swiss-Prot	Medium
`O64782`	Arabidopsis thaliana	sp\|O64782\|SD129_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase SD1-29	35.600%	Swiss-Prot	Medium
`O64778`	Arabidopsis thaliana	sp\|O64778\|Y1142_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At1g61420	34.300%	Swiss-Prot	Medium
`Q9SYA0`	Arabidopsis thaliana	sp\|Q9SYA0\|Y1150_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At1g61500	34.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card