TkA06G242160 | RubberDandelionOmics

Gene overview

TkA06G242160

Reference: TK1151 Chr: Chr06 Coordinates: 61993325-61993956 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

570 bp · TkA06G242160|TK1151|cDNA

GGCGGCGTATCCCACGAAATAATCCGAAGTTTTCGATTTAATTTAGAGGAAATAGAGGCCGCCACACAGTATTTCGCCCCCGGGAATTTACTGGGCAAAAGCGTCTTTTCAGCCATTCATAAAGGAATGTTGAGAGATGGAACTATTGTTGCTATTAAGAGTATTATTAAGAGTAGCTGTAAGTCCGAAGAAGTCGAGTTTTTGAAAGGACTGAATGTTTTGAATTCTTTAAGACACGAGAATTTAGTGAGGTTGAGAGG...

CDS

Download CDS FASTA

570 bp · TkA06G242160|TK1151|CDS

GGCGGCGTATCCCACGAAATAATCCGAAGTTTTCGATTTAATTTAGAGGAAATAGAGGCCGCCACACAGTATTTCGCCCCCGGGAATTTACTGGGCAAAAGCGTCTTTTCAGCCATTCATAAAGGAATGTTGAGAGATGGAACTATTGTTGCTATTAAGAGTATTATTAAGAGTAGCTGTAAGTCCGAAGAAGTCGAGTTTTTGAAAGGACTGAATGTTTTGAATTCTTTAAGACACGAGAATTTAGTGAGGTTGAGAGG...

Protein

Download Protein FASTA

189 aa · TkA06G242160|TK1151|PROTEIN

GGVSHEIIRSFRFNLEEIEAATQYFAPGNLLGKSVFSAIHKGMLRDGTIVAIKSIIKSSCKSEEVEFLKGLNVLNSLRHENLVRLRGFCCSKGRGECFLIYDFVPNGNLLSYLDMKDDGHVLDWSTRASIINGIARGIEYLHGSKLNKPVLVHQNISVKNVLLDQRFKPLLSDSGLHQLLTKDTVFFVT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G242160`
TK1151 ID	TkA06G242160
OH-1004 ID	LXL04_012011
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.800
Protein coverage (%)	TK1151 98.413 / OH-1004 26.458 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G242160

Location Chr06:61993325-61993956 (+)

Description Similar to NIK2: Protein NSP-INTERACTING KINASE 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g61460`	G-type lectin S-receptor-like serine/threonine-protein kinase At1g61460.	No verified direct reference in this release
`At4g23250`	Cysteine-rich receptor-like protein kinase 17.	No verified direct reference in this release
`At1g61420`	G-type lectin S-receptor-like serine/threonine-protein kinase At1g61420.	No verified direct reference in this release
`At1g01540`	Probable serine/threonine-protein kinase At1g01540.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012011 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009611 response to wounding Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0042659 regulation of cell fate specification Biological Process

GO:0045184 establishment of protein localization Biological Process

GO:0048638 regulation of developmental growth Biological Process

GO:0051302 regulation of cell division Biological Process

GO:0055075 potassium ion homeostasis Biological Process

GO:0090708 specification of plant organ axis polarity Biological Process

GO:0160073 Casparian strip assembly Biological Process

KEGG gene cross-reference

ath:AT3G25560

ath:AT4G20140

dosa:Os02g0283800

osa:4329032

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.537

Rank 1 · TkA06G242160 · TK1151

Cytoplasm0.327

Rank 2 · TkA06G242160 · TK1151

Nucleus0.255

Rank 3 · TkA06G242160 · TK1151

Endoplasmic reticulum0.036

Rank 4 · TkA06G242160 · TK1151

Golgi apparatus0.027

Rank 5 · TkA06G242160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714PK_Tyr_Ser-Thr29-183 aa

PF00069Pkinase29-184 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G242160	`PF07714`	PK_Tyr_Ser-Thr	29	183	2.1e-24	86.9
TkA06G242160	`PF00069`	Pkinase	29	184	1.4e-16	61.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64774`	Arabidopsis thaliana	sp\|O64774\|Y1146_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At1g61460	37.900%	Swiss-Prot	Medium
`Q8L710`	Arabidopsis thaliana	sp\|Q8L710\|CRK17_ARATH Cysteine-rich receptor-like protein kinase 17	40.200%	Swiss-Prot	Medium
`O64778`	Arabidopsis thaliana	sp\|O64778\|Y1142_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At1g61420	38.900%	Swiss-Prot	Medium
`Q3EDL4`	Arabidopsis thaliana	sp\|Q3EDL4\|Y1154_ARATH Probable serine/threonine-protein kinase At1g01540	37.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card