TkA06G058550 | RubberDandelionOmics

Gene overview

TkA06G058550

Reference: TK1151 Chr: Chr06 Coordinates: 15821509-15824890 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

858 bp · TkA06G058550|TK1151|cDNA

ATGTTAAATGGGGAAGCTAGCGATGAAGAAGTCACAAAAGTTTGCAAAATTGCATGTCGGTGTATCCAATATGAGGAAGAGAGTAGACCCTCAATGAGTCAGGTGGAACAAATGCTTGAAGGGGTTTTGGATGTGAACAGGCCTCCCATACCCAATATGAGGAAGAGAGTAGATCCTGTTGTTTTCTCCACGGAGTCACCATCCAACGAGAGCTCACAGATAAAGGAGTCTCTTGACAATTTGAGGCAAATTTATTACCG...

CDS

Download CDS FASTA

858 bp · TkA06G058550|TK1151|CDS

ATGTTAAATGGGGAAGCTAGCGATGAAGAAGTCACAAAAGTTTGCAAAATTGCATGTCGGTGTATCCAATATGAGGAAGAGAGTAGACCCTCAATGAGTCAGGTGGAACAAATGCTTGAAGGGGTTTTGGATGTGAACAGGCCTCCCATACCCAATATGAGGAAGAGAGTAGATCCTGTTGTTTTCTCCACGGAGTCACCATCCAACGAGAGCTCACAGATAAAGGAGTCTCTTGACAATTTGAGGCAAATTTATTACCG...

Protein

Download Protein FASTA

285 aa · TkA06G058550|TK1151|PROTEIN

MLNGEASDEEVTKVCKIACRCIQYEEESRPSMSQVEQMLEGVLDVNRPPIPNMRKRVDPVVFSTESPSNESSQIKESLDNLRQIYYRNIPYHDHTSSSSWSNTTTATLSPNTSETTTHESKLESSRPLQGGFGWLSGNSLVVEKNSNDPYVDFRESMLQMIMENEIYGKDELRELLNCFLQLNSPYYHGVIVGAFTSEGFNCSTISSQLYNVNLSLNSLTGYVPVSLSQSNSLMFLSLQFNNFSGVLPDSWGGGKNDDKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G058550`
TK1151 ID	TkA06G058550
OH-1004 ID	LXL04_025449
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 39.365 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G058550

Location Chr06:15821509-15824890 (-)

Description Similar to SD22: G-type lectin S-receptor-like serine/threonine-protein kinase SD2-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52525`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release
`At4g18830`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	A central role of Arabidopsis thaliana ovate family proteins in networking and subcellular localization of 3-aa loop extension homeodomain proteins.2005 · DOI: 10.1073/pnas.0501181102 Cell-fate switch of synergid to egg cell in Arabidopsis eostre mutant embryo sacs arises from misexpression of the BEL1-like homeodomain gene BLH1.2007 · DOI: 10.1105/tpc.107.054890 Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development.2011 · DOI: 10.1371/journal.pone.0023896
`At2g19130`	G-type lectin S-receptor-like serine/threonine-protein kinase At2g19130.	No verified direct reference in this release
`At5g19650`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development.2011 · DOI: 10.1371/journal.pone.0023896

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0864000`	Probable transcriptional repressor that regulates multiple aspects of plant growth and development, partly through brassinosteroid (BR) signaling pathway.	OVATE Family Protein 8 Positively Mediates Brassinosteroid Signaling through Interacting with the GSK3-like Kinase in Rice.2016 · DOI: 10.1371/journal.pgen.1006118

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025449 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0048544 recognition of pollen Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0030246 carbohydrate binding Molecular Function

GO:0031625 ubiquitin protein ligase binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G19130

ath:AT4G00340

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.358

Rank 1 · TkA06G058550 · TK1151

Nucleus0.306

Rank 2 · TkA06G058550 · TK1151

Cytoplasm0.236

Rank 3 · TkA06G058550 · TK1151

Endoplasmic reticulum0.144

Rank 4 · TkA06G058550 · TK1151

Lysosome / Vacuole0.076

Rank 5 · TkA06G058550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04844Ovate32-47 aa

PF00560LRR_1135-141 aa

PF04844Ovate146-196 aa

PF00560LRR_1209-228 aa

PF13855LRR_8211-243 aa

PF00560LRR_1232-252 aa

PF00560LRR_1263-277 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G058550	`PF04844`	Ovate	32	47	1.6e-22	80.0
TkA06G058550	`PF00560`	LRR_1	135	141	0.007	16.9
TkA06G058550	`PF04844`	Ovate	146	196	1.6e-22	80.0
TkA06G058550	`PF00560`	LRR_1	209	228	0.007	16.9
TkA06G058550	`PF13855`	LRR_8	211	243	0.0093	16.4
TkA06G058550	`PF00560`	LRR_1	232	252	0.007	16.9
TkA06G058550	`PF00560`	LRR_1	263	277	0.007	16.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3EAL1`	Arabidopsis thaliana	sp\|Q3EAL1\|OFP6_ARATH Transcription repressor OFP6	69.400%	Swiss-Prot	Low
`Q8VZN1`	Arabidopsis thaliana	sp\|Q8VZN1\|OFP5_ARATH Transcription repressor OFP5	45.600%	Swiss-Prot	Low
`O64477`	Arabidopsis thaliana	sp\|O64477\|Y2913_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At2g19130	56.900%	Swiss-Prot	Low
`Q3E9B4`	Arabidopsis thaliana	sp\|Q3E9B4\|OFP8_ARATH Transcription repressor OFP8	54.400%	Swiss-Prot	Low
`Q94CV1`	Oryza sativa subsp. japonica	sp\|Q94CV1\|OFP8_ORYSJ Transcription repressor OFP8	47.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card