TkA06G053370 | RubberDandelionOmics

Gene overview

TkA06G053370

Reference: TK1151 Chr: Chr06 Coordinates: 14401239-14402706 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

870 bp · TkA06G053370|TK1151|cDNA

ATGGCCGCTGTTGCTTCAATTTCATTCTGCGGAGTGACTCAATCATCATCCGAAAGAAAAATCTCGCGCTCTCTTCTTTCTAATTCCGATGCGCTTAGGGTTCGTACAACCTTCTCATTTCATTCCATAAGCGTTCGCCCTTCGAAATCGAGTTCTCGCTTTGCAGTTCACTGCATGTCTACAGGATCAGAACCACCACCAGTCTCCGAGACAAAATCAAAATTTCTCCAAGCTTACAAACGCCCAATACCAAGCATCTA...

CDS

Download CDS FASTA

870 bp · TkA06G053370|TK1151|CDS

ATGGCCGCTGTTGCTTCAATTTCATTCTGCGGAGTGACTCAATCATCATCCGAAAGAAAAATCTCGCGCTCTCTTCTTTCTAATTCCGATGCGCTTAGGGTTCGTACAACCTTCTCATTTCATTCCATAAGCGTTCGCCCTTCGAAATCGAGTTCTCGCTTTGCAGTTCACTGCATGTCTACAGGATCAGAACCACCACCAGTCTCCGAGACAAAATCAAAATTTCTCCAAGCTTACAAACGCCCAATACCAAGCATCTA...

Protein

Download Protein FASTA

289 aa · TkA06G053370|TK1151|PROTEIN

MAAVASISFCGVTQSSSERKISRSLLSNSDALRVRTTFSFHSISVRPSKSSSRFAVHCMSTGSEPPPVSETKSKFLQAYKRPIPSIYNSVLQELIVQQHLMRYKKTYRYDAVFALGFVTVYDQLMEGYPSDEDREAIFQSYINALNEDPQKYRADAAKMETWARTQNSTSLVDFSSKSGEIEDILKDIAERAGGNGNFSYSRFFAVGLFRLLELANATDPTVLEKLCAALKIEKRSVDRDLDVYRNLLSKLVQAKELLKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G053370`
TK1151 ID	TkA06G053370
OH-1004 ID	LXL04_025545
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G053370

Location Chr06:14401239-14402706 (-)

Description Similar to THF1: Protein THYLAKOID FORMATION1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20890`	Involved in a dynamic process of vesicle-mediated thylakoid membrane biogenesis.	Deletion of the chloroplast-localized Thylakoid formation1 gene product in Arabidopsis leads to deficient thylakoid formation and variegated leaves.2004 · DOI: 10.1104/pp.104.049841 The plastid protein THYLAKOID FORMATION1 and the plasma membrane G-protein GPA1 interact in a novel sugar-signaling mechanism in Arabidopsis.2006 · DOI: 10.1105/tpc.105.037259

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0558500`	Involved in a dynamic process of vesicle-mediated thylakoid membrane biogenesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025545 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007186 G protein-coupled receptor signaling pathway Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0010182 sugar mediated signaling pathway Biological Process

GO:0010207 photosystem II assembly Biological Process

GO:0015996 chlorophyll catabolic process Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:0045038 protein import into chloroplast thylakoid membrane Biological Process

GO:0050829 defense response to Gram-negative bacterium Biological Process

GO:0072597 maintenance of protein location in chloroplast Biological Process

GO:1902458 positive regulation of stomatal opening Biological Process

GO:1903426 regulation of reactive oxygen species biosynthetic process Biological Process

GO:2000070 regulation of response to water deprivation Biological Process

KEGG gene cross-reference

ath:AT2G20890

cyn:Cyan7425_5166

dosa:Os07g0558500

sot:102577610

ter:Tery_1168

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.969

Rank 1 · TkA06G053370 · TK1151

Mitochondrion0.035

Rank 2 · TkA06G053370 · TK1151

Nucleus0.026

Rank 3 · TkA06G053370 · TK1151

Cytoplasm0.016

Rank 4 · TkA06G053370 · TK1151

Cell membrane0.010

Rank 5 · TkA06G053370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11264ThylakoidFormat68-272 aa

PF13476AAA_23165-278 aa

PF15503PPP1R35_C236-286 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G053370	`PF11264`	ThylakoidFormat	68	272	1.2e-74	251.4
TkA06G053370	`PF13476`	AAA_23	165	278	0.075	14.4
TkA06G053370	`PF15503`	PPP1R35_C	236	286	0.038	14.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SKT0`	Arabidopsis thaliana	sp\|Q9SKT0\|THF1_ARATH Protein THYLAKOID FORMATION 1, chloroplastic	71.300%	Swiss-Prot	High
`Q84PB7`	Oryza sativa subsp. japonica	sp\|Q84PB7\|THF1_ORYSJ Protein THYLAKOID FORMATION1, chloroplastic	75.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card