TkA04G309700 | RubberDandelionOmics

Gene overview

TkA04G309700

Reference: TK1151 Chr: Chr04 Coordinates: 78130571-78132200 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1329 bp · TkA04G309700|TK1151|cDNA

ATGGCCGATCATATGAGCAATTTACCTGATTGTATTATTCATCACATTCTGTCATTTATGCCCACAAAAGAAGCGGTAAAGACGTCCATATTATCTACAAGATGGAAGAACCTCTGGGCTTCTGTCCCCACCATTGATTTTGATGATGATTTGTTGCACGCTAAAGGTAGGCGTACGGCTGATATGACTTCCTTTATGAATTTTGTAGAAAGAGTCTTACAGTTACGTGATTCATTGAGTATGGAGAAGTTTCGTCTATC...

CDS

Download CDS FASTA

1329 bp · TkA04G309700|TK1151|CDS

ATGGCCGATCATATGAGCAATTTACCTGATTGTATTATTCATCACATTCTGTCATTTATGCCCACAAAAGAAGCGGTAAAGACGTCCATATTATCTACAAGATGGAAGAACCTCTGGGCTTCTGTCCCCACCATTGATTTTGATGATGATTTGTTGCACGCTAAAGGTAGGCGTACGGCTGATATGACTTCCTTTATGAATTTTGTAGAAAGAGTCTTACAGTTACGTGATTCATTGAGTATGGAGAAGTTTCGTCTATC...

Protein

Download Protein FASTA

442 aa · TkA04G309700|TK1151|PROTEIN

MADHMSNLPDCIIHHILSFMPTKEAVKTSILSTRWKNLWASVPTIDFDDDLLHAKGRRTADMTSFMNFVERVLQLRDSLSMEKFRLSCRVYCDAYQIRSWISDAIMHDVRELDLSLFQVYSYAIPESMFHSTSLVSLKIILHYNMKFPSYVSFPRLKTLQLTYGQYVDNEYTEILLSGCPVLEELALFTNTFRSNIAISSPSLKSFTICDEPILIYGKFYYGSSYKINIDATNLTNFEYTGSLSNQILLDNVSNLVKACI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G309700`
TK1151 ID	TkA04G309700
OH-1004 ID	LXL04_037459
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	97.400
Protein coverage (%)	TK1151 95.701 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G309700

Location Chr04:78130571-78132200 (+)

Description Similar to At3g03040: F-box protein At3g03040

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14096`	F-box/LRR-repeat protein At4g14096.	No verified direct reference in this release
`At3g58860`	Putative F-box protein At3g58860.	No verified direct reference in this release
`At3g59230`	Putative F-box/LRR-repeat protein At3g59230.	No verified direct reference in this release
`At3g03040`	F-box protein At3g03040.	No verified direct reference in this release
`At3g58900`	F-box/LRR-repeat protein At3g58900.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037459 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G03040

ath:AT3G58860

ath:AT3G58900

ath:AT3G59210

ath:AT4G14096

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.725

Rank 1 · TkA04G309700 · TK1151

Cytoplasm0.346

Rank 2 · TkA04G309700 · TK1151

Endoplasmic reticulum0.046

Rank 3 · TkA04G309700 · TK1151

Cell membrane0.042

Rank 4 · TkA04G309700 · TK1151

Plastid0.018

Rank 5 · TkA04G309700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box5-43 aa

PF12937F-box-like5-38 aa

PF08387FBD6-16 aa

PF25363DUF7881_C29-79 aa

PF24758LRR_At5g5637098-210 aa

PF25363DUF7881_C148-191 aa

PF07723LRR_2155-180 aa

PF17856TIP49_C273-296 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G309700	`PF00646`	F-box	5	43	3.8e-10	39.9
TkA04G309700	`PF12937`	F-box-like	5	38	0.0079	16.6
TkA04G309700	`PF08387`	FBD	6	16	3.1e-08	34.1
TkA04G309700	`PF25363`	DUF7881_C	29	79	0.047	14.3
TkA04G309700	`PF24758`	LRR_At5g56370	98	210	6.4e-18	66.0
TkA04G309700	`PF25363`	DUF7881_C	148	191	0.047	14.3
TkA04G309700	`PF07723`	LRR_2	155	180	0.0053	18.1
TkA04G309700	`PF17856`	TIP49_C	273	296	0.097	13.6
TkA04G309700	`PF24758`	LRR_At5g56370	283	348	6.4e-18	66.0
TkA04G309700	`PF17856`	TIP49_C	315	338	0.097	13.6
TkA04G309700	`PF25363`	DUF7881_C	323	358	0.047	14.3
TkA04G309700	`PF12937`	F-box-like	326	343	0.0079	16.6
TkA04G309700	`PF07723`	LRR_2	328	335	0.0053	18.1
TkA04G309700	`PF07723`	LRR_2	336	345	0.0053	18.1
TkA04G309700	`PF08387`	FBD	364	403	3.1e-08	34.1
TkA04G309700	`PF07723`	LRR_2	370	377	0.0053	18.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94B46`	Arabidopsis thaliana	sp\|Q94B46\|FBL74_ARATH F-box/LRR-repeat protein At4g14096	32.400%	Swiss-Prot	Medium
`Q9LXR6`	Arabidopsis thaliana	sp\|Q9LXR6\|FB207_ARATH Putative F-box protein At3g58860	29.500%	Swiss-Prot	Low
`Q9LX48`	Arabidopsis thaliana	sp\|Q9LX48\|FBL66_ARATH Putative F-box/LRR-repeat protein At3g59230	32.800%	Swiss-Prot	Medium
`Q9LDJ9`	Arabidopsis thaliana	sp\|Q9LDJ9\|FB133_ARATH F-box protein At3g03040	31.400%	Swiss-Prot	Medium
`Q93ZX6`	Arabidopsis thaliana	sp\|Q93ZX6\|FBL57_ARATH F-box/LRR-repeat protein At3g58900	35.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card