TkA04G175210 | RubberDandelionOmics

Gene overview

TkA04G175210

Reference: TK1151 Chr: Chr04 Coordinates: 45380012-45382397 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1604 bp · TkA04G175210|TK1151|cDNA

TATCCAATAGCCGAGGTTTTGAGTTTTGGTTGGCGAAGGTTTATCAATCATCAATGGCGTTGCTACAGTTTATGTGCTCCGTAACGCCACTTGCACGTGCCGCAAGGTCACGTTCCCTCATCGTCTCCTCCTCCCGAACCGTCGTCACTGTCCCCACTACCACTACCACTACCATCACAAGTAGCAAGATAAAGGTGTCGCCACCAGACTCGAACGTGCTTCTCGGCATGTCTGAGGAACAGCTTCAACAGCTCGCTATT...

CDS

Download CDS FASTA

1269 bp · TkA04G175210|TK1151|CDS

ATGGCGTTGCTACAGTTTATGTGCTCCGTAACGCCACTTGCACGTGCCGCAAGGTCACGTTCCCTCATCGTCTCCTCCTCCCGAACCGTCGTCACTGTCCCCACTACCACTACCACTACCATCACAAGTAGCAAGATAAAGGTGTCGCCACCAGACTCGAACGTGCTTCTCGGCATGTCTGAGGAACAGCTTCAACAGCTCGCTATTGACTTCGGTCAGCAAAGTTATAGAGGCAAACAGTTGCATCATCTTCTGTACAA...

Protein

Download Protein FASTA

422 aa · TkA04G175210|TK1151|PROTEIN

MALLQFMCSVTPLARAARSRSLIVSSSRTVVTVPTTTTTTITSSKIKVSPPDSNVLLGMSEEQLQQLAIDFGQQSYRGKQLHHLLYKRRVKDIQEFSQVPLAFRTELQEAGWVVGRSSVHSSVKAADGTIKLLIKLEDNRLVETVGIPVADDKGSVRLTCCVSSQVGCPLRCSFCATGKGGFSRNLKGHEIVEQVLAIEEVFNNRVTNVVFMGMGEPMLNLKEVLAAHRCLNKDVQIGQRMMTISTVGVPNTIKKLASHK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G175210`
TK1151 ID	TkA04G175210
OH-1004 ID	LXL04_035047
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.300
Protein coverage (%)	TK1151 100.000 / OH-1004 89.212 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G175210`
Location	Chr04:45380012-45382397 (+)
Description	Similar to rlmN: Probable dual-specificity RNA methyltransferase RlmN (Acaryochloris marina (strain MBIC 11017)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035047` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0030488 tRNA methylation Biological Process GO:0070475 rRNA base methylation Biological Process GO:0005737 cytoplasm Cellular Component GO:0000049 tRNA binding Molecular Function GO:0002935 tRNA (adenine(37)-C2)-methyltransferase activity Molecular Function GO:0019843 rRNA binding Molecular Function GO:0046872 metal ion binding Molecular Function GO:0051539 4 iron, 4 sulfur cluster binding Molecular Function GO:0070040 rRNA (adenine(2503)-C2-)-methyltransferase activity Molecular Function
KEGG gene cross-reference	amr:AM1_3982 cya:CYA_2570 gvi:gll2079 npu:Npun_F3954 tel:tll2425 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.555

Rank 1 · TkA04G175210 · TK1151

Mitochondrion0.541

Rank 2 · TkA04G175210 · TK1151

Cytoplasm0.055

Rank 3 · TkA04G175210 · TK1151

Nucleus0.050

Rank 4 · TkA04G175210 · TK1151

Cell membrane0.011

Rank 5 · TkA04G175210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27693Herpes_UL531-82 aa

PF21016RlmN_N56-109 aa

PF04055Radical_SAM163-324 aa

PF19238Radical_SAM_2164-175 aa

PF13353Fer4_12165-236 aa

PF19238Radical_SAM_2252-331 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G175210	`PF27693`	Herpes_UL5	31	82	0.16	12.5
TkA04G175210	`PF21016`	RlmN_N	56	109	1.6e-06	28.5
TkA04G175210	`PF04055`	Radical_SAM	163	324	1.8e-17	64.7
TkA04G175210	`PF19238`	Radical_SAM_2	164	175	0.16	12.4
TkA04G175210	`PF13353`	Fer4_12	165	236	0.0038	18.3
TkA04G175210	`PF19238`	Radical_SAM_2	252	331	0.16	12.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card