TkA04G129610 | RubberDandelionOmics

Gene overview

TkA04G129610

Reference: TK1151 Chr: Chr04 Coordinates: 33725920-33728619 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1798 bp · TkA04G129610|TK1151|cDNA

TTCAAACTACGAAGAAATACTCTTCTCAAGGAGAGGCTAGCCACCGGATCTTTCTCGACTGTTCTCATTCTCTTCGTCAACCTATAAATCCTGCAGTTGCAGGTATTTGTTATGAAAACCTGTTCATTCGTTCAACACTGGCCGAATTAACCATCGCAGTTGCAGATTTTAGATGGAAACAGGAGGCAATTCCCTAGCATCTGGGCCAGATGGAGTGAAGAGAAAGGTGTACTACTTCTATGATCCAGAGGTCGGAAACT...

CDS

Download CDS FASTA

1488 bp · TkA04G129610|TK1151|CDS

ATGGAAACAGGAGGCAATTCCCTAGCATCTGGGCCAGATGGAGTGAAGAGAAAGGTGTACTACTTCTATGATCCAGAGGTCGGAAACTACTACTATGGACAAGGTCACCCAATGAAGCCCCACAGAATTCGCATGACACATGCCCTCCTAGCCCACTATGGCTTACTTCAAAACATGCATGTTGTAAAGCCAGTTCCAGCTAGAGACAAAGATCTCTGCAGATTCCATGCTGATGATTACGTGTCCTTTCTAAGAGGCAT...

Protein

Download Protein FASTA

495 aa · TkA04G129610|TK1151|PROTEIN

METGGNSLASGPDGVKRKVYYFYDPEVGNYYYGQGHPMKPHRIRMTHALLAHYGLLQNMHVVKPVPARDKDLCRFHADDYVSFLRGITPETQQDQLRQLKRFNVGEDCPVFDGLYSFCQTYAGGSVGGAVKLNHEYCDIAINWAGGLHHAKKCEASGFCYVNDIVLSILELLKVHQRVLYVDIDIHHGDGVEEAFYTTDRVMTVSFHKFGDYFPGTGDIRDIGYSKGKYYSLNVPLDDGIDDESYQSLFKPIIGKVMEVF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G129610`
TK1151 ID	TkA04G129610
OH-1004 ID	LXL04_035457
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G129610

Location Chr04:33725920-33728619 (+)

Description Similar to HDA19: Histone deacetylase 19

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g38130`	Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4).	Functional analysis of a RPD3 histone deacetylase homologue in Arabidopsis thaliana.2000 · DOI: 10.1023/a:1006498413543 HISTONE DEACETYLASE19 is involved in jasmonic acid and ethylene signaling of pathogen response in Arabidopsis.2005 · DOI: 10.1105/tpc.104.028514 Arabidopsis thaliana histone deacetylase 1 (AtHD1) is localized in euchromatic regions and demonstrates histone deacetylase activity in vitro.2006 · DOI: 10.1038/sj.cr.7310059 APETALA2 negatively regulates multiple floral organ identity genes in Arabidopsis by recruiting the co-repressor TOPLESS and the histone deacetylase HDA19.2012 · DOI: 10.1242/dev.085407 The Distinct Roles of Class I and II RPD3-Like Histone Deacetylases in Salinity Stress Response.2017 · DOI: 10.1104/pp.17.01332

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0583400`	Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4).	Structure and expression of the rice class-I type histone deacetylase genes OsHDAC1-3: OsHDAC1 overexpression in transgenic plants leads to increased growth rate and altered architecture.2003 · DOI: 10.1046/j.1365-313x.2003.01650.x The histone deacetylase OsHDAC1 epigenetically regulates the OsNAC6 gene that controls seedling root growth in rice.2009 · DOI: 10.1111/j.1365-313x.2009.03908.x MODD Mediates Deactivation and Degradation of OsbZIP46 to Negatively Regulate ABA Signaling and Drought Resistance in Rice.2016 · DOI: 10.1105/tpc.16.00171
`Os02g0215200`	Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4).	No verified direct reference in this release
`Os02g0214900`	Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035457 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009294 DNA-mediated transformation Biological Process

GO:0009861 jasmonic acid and ethylene-dependent systemic resistance Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:1901001 negative regulation of response to salt stress Biological Process

GO:1902459 positive regulation of stem cell population maintenance Biological Process

GO:2000026 regulation of multicellular organismal development Biological Process

GO:0000118 histone deacetylase complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0070822 Sin3-type complex Cellular Component

KEGG gene cross-reference

ath:AT4G38130

dosa:Os02g0214900

dosa:Os02g0215200

dosa:Os06g0583400

osa:4328720

osa:4341387

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.765

Rank 1 · TkA04G129610 · TK1151

Cytoplasm0.375

Rank 2 · TkA04G129610 · TK1151

Mitochondrion0.050

Rank 3 · TkA04G129610 · TK1151

Cell membrane0.033

Rank 4 · TkA04G129610 · TK1151

Endoplasmic reticulum0.022

Rank 5 · TkA04G129610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00850Hist_deacetyl36-324 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G129610	`PF00850`	Hist_deacetyl	36	324	2.4e-86	290.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22446`	Arabidopsis thaliana	sp\|O22446\|HDA19_ARATH Histone deacetylase 19	80.200%	Swiss-Prot	High
`Q7Y0Y8`	Oryza sativa subsp. japonica	sp\|Q7Y0Y8\|HDAC1_ORYSJ Histone deacetylase 1	89.300%	Swiss-Prot	High
`Q6YV04`	Oryza sativa subsp. japonica	sp\|Q6YV04\|HDAC2_ORYSJ Histone deacetylase 2	81.500%	Swiss-Prot	High
`Q7Y0Y6`	Oryza sativa subsp. japonica	sp\|Q7Y0Y6\|HDAC3_ORYSJ Histone deacetylase 3	80.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card