TkA04G062330 | RubberDandelionOmics

Gene overview

TkA04G062330

Reference: TK1151 Chr: Chr04 Coordinates: 16629416-16633944 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2569 bp · TkA04G062330|TK1151|cDNA

ATTTCTTTACTGTCAATTTGATCATTCTTAGTACAAGTAGCCAAAGTTATGCATTTATCATGTATACACGTAATTATCATTCATCCTAAATCAGTTGATAGATAACAATACCAAAACACATGACAAAAAGGTTGAAATCGAGCTTTTTCAACTACCAACCTCTTACATATTAATGGCCGTTGCTGAAGCTGGCAGCACAAACCCATGCTTCCATAACATTAATTGCACAATAATGCGGAAGGTTTAGCACCCATTCCCAC...

CDS

Download CDS FASTA

1392 bp · TkA04G062330|TK1151|CDS

ATGGTGGGTAACATTGAGGTAATGACATCTAGTCTATACCAAAACGGAGCAATTTCAAATCATAACGGTTTAGAGGAAAAACTAGACGAATTCCGACGAGTGCTCGGTAAATCCGATGGTGATTTGCTGAAAATAGTCGGAGTTGGGGCAGGTGCATGGGGCAGTGTTTTCGCAGCTTTACTTCAAGACACCTACGGAAAGTTTCGCGACAAAGTTCAAATCCGGATATGGCGACGGGCAGGTCGGGCAGTCGATCGAGA...

Protein

Download Protein FASTA

463 aa · TkA04G062330|TK1151|PROTEIN

MVGNIEVMTSSLYQNGAISNHNGLEEKLDEFRRVLGKSDGDLLKIVGVGAGAWGSVFAALLQDTYGKFRDKVQIRIWRRAGRAVDRETAKLLFEVINSREDVLRRLIRRCAYLKYVEARLGDRVLYADEILKDGFCLNMIDTPLSPMKVVTNLQEAVWDADIVVNGVPSTETREVFEEIGNYWKERISPPIIVSLSKGIEAALDPVPHIITPTQMINRATRVPLENILYLGGPNIASEIYNKEYANARICGTEKWRVPLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G062330`
TK1151 ID	TkA04G062330
OH-1004 ID	LXL04_036230
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G062330

Location Chr04:16629416-16633944 (-)

Description Similar to Os01g0939600: Probable glycerol-3-phosphate dehydrogenase [NAD(+)] 1, cytosolic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g41540`	Involved in cell redox homeostasis.	Involvement of a glycerol-3-phosphate dehydrogenase in modulating the NADH/NAD+ ratio provides evidence of a mitochondrial glycerol-3-phosphate shuttle in Arabidopsis.2006 · DOI: 10.1105/tpc.105.039750
`At3g07690`	Required for glycerol-3-phosphate (G3P) accumulation during systemic acquired resistance (SAR) establishment.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0939600`	May be involved in cell redox homeostasis.	No verified direct reference in this release
`Os01g0801600`	May be involved in cell redox homeostasis.	No verified direct reference in this release
`Os05g0495700`	May be involved in cell redox homeostasis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036230 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006072 glycerol-3-phosphate metabolic process Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0046168 glycerol-3-phosphate catabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0047952 glycerol-3-phosphate dehydrogenase [NAD(P)+] activity Molecular Function

GO:0051287 NAD binding Molecular Function

GO:0141152 glycerol-3-phosphate dehydrogenase (NAD+) activity Molecular Function

KEGG gene cross-reference

ath:AT2G41540

ath:AT3G07690

dosa:Os01g0801600

dosa:Os01g0939600

dosa:Os05g0495700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.587

Rank 1 · TkA04G062330 · TK1151

Nucleus0.320

Rank 2 · TkA04G062330 · TK1151

Cell membrane0.096

Rank 3 · TkA04G062330 · TK1151

Mitochondrion0.096

Rank 4 · TkA04G062330 · TK1151

Lysosome / Vacuole0.074

Rank 5 · TkA04G062330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25417DUF788927-45 aa

PF01210NAD_Gly3P_dh_N44-81 aa

PF02558ApbA48-88 aa

PF03435Sacchrp_dh_NADP48-91 aa

PF25417DUF788975-81 aa

PF02558ApbA127-202 aa

PF01210NAD_Gly3P_dh_N147-248 aa

PF07479NAD_Gly3P_dh_C275-429 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G062330	`PF25417`	DUF7889	27	45	0.63	10.0
TkA04G062330	`PF01210`	NAD_Gly3P_dh_N	44	81	3.8e-15	56.9
TkA04G062330	`PF02558`	ApbA	48	88	0.026	14.9
TkA04G062330	`PF03435`	Sacchrp_dh_NADP	48	91	0.28	12.2
TkA04G062330	`PF25417`	DUF7889	75	81	0.63	10.0
TkA04G062330	`PF02558`	ApbA	127	202	0.026	14.9
TkA04G062330	`PF01210`	NAD_Gly3P_dh_N	147	248	3.8e-15	56.9
TkA04G062330	`PF07479`	NAD_Gly3P_dh_C	275	429	4.2e-18	66.7
TkA04G062330	`PF03435`	Sacchrp_dh_NADP	290	303	0.28	12.2
TkA04G062330	`PF25417`	DUF7889	426	441	0.63	10.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22216`	Arabidopsis thaliana	sp\|O22216\|GPDHC_ARATH Glycerol-3-phosphate dehydrogenase [NAD(+)] GPDHC1, cytosolic	84.500%	Swiss-Prot	High
`Q9S785`	Arabidopsis thaliana	sp\|Q9S785\|GPDH2_ARATH Glycerol-3-phosphate dehydrogenase [NAD(+)] At3g07690, cytosolic	80.200%	Swiss-Prot	High
`Q8S0G4`	Oryza sativa subsp. japonica	sp\|Q8S0G4\|GPDH1_ORYSJ Probable glycerol-3-phosphate dehydrogenase [NAD(+)] 1, cytosolic	85.500%	Swiss-Prot	High
`Q8S2G5`	Oryza sativa subsp. japonica	sp\|Q8S2G5\|GPDH2_ORYSJ Probable glycerol-3-phosphate dehydrogenase [NAD(+)] 2, cytosolic	83.000%	Swiss-Prot	High
`Q65X70`	Oryza sativa subsp. japonica	sp\|Q65X70\|GPDH3_ORYSJ Probable glycerol-3-phosphate dehydrogenase [NAD(+)] 3, cytosolic	81.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card