LXL04_036230 | RubberDandelionOmics

Gene overview

LXL04_036230

Reference: OH-1004 Chr: Chr08 Coordinates: 38252362-38254866 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1392 bp · LXL04_036230|LXL04_036230|OH1004|cDNA

ATGGTGGGTAACATTGAGGTAATGACATCTAGTCTATACCAAAACGGAGCAATTTCAAATCATAACGGTTTAGAGGAAAAACTAGACGAATTCCGACGAGTGCTCGGTAAATCCGATGGTGATTTGCTGAAAATAGTCGGAGTTGGGGCAGGTGCATGGGGCAGTGTTTTCGCAGCTTTACTTCAAGACACCTACGGAAAGTTTCGCGACAAAGTTCAAATCCGGATATGGCGACGGGCAGGTCGGGCAGTCGATCGAGA...

CDS

Download CDS FASTA

1392 bp · LXL04_036230|LXL04_036230|OH1004|CDS

ATGGTGGGTAACATTGAGGTAATGACATCTAGTCTATACCAAAACGGAGCAATTTCAAATCATAACGGTTTAGAGGAAAAACTAGACGAATTCCGACGAGTGCTCGGTAAATCCGATGGTGATTTGCTGAAAATAGTCGGAGTTGGGGCAGGTGCATGGGGCAGTGTTTTCGCAGCTTTACTTCAAGACACCTACGGAAAGTTTCGCGACAAAGTTCAAATCCGGATATGGCGACGGGCAGGTCGGGCAGTCGATCGAGA...

Protein

Download Protein FASTA

463 aa · LXL04_036230|LXL04_036230|OH1004|PROTEIN

MVGNIEVMTSSLYQNGAISNHNGLEEKLDEFRRVLGKSDGDLLKIVGVGAGAWGSVFAALLQDTYGKFRDKVQIRIWRRAGRAVDRETAKLLFEVINSREDVLRRLIRRCAYLKYVEARLGDRVLYADEILKDGFCLNMIDTPLSPMKVVTNLQEAVWDADIVVNGVPSTETREVFEEIGNYWKERISPPIIVSLSKGIEAALDPVPHIITPTQMINRATRVPLENILYLGGPNIASEIYNKEYANARICGTEKWRVPLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036230`
TK1151 ID	TkA04G062330
OH-1004 ID	LXL04_036230
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036230

Location Chr08:38252362-38254866 (+)

Description Similar to Os01g0939600: Probable glycerol-3-phosphate dehydrogenase [NAD(+)] 1, cytosolic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g41540`	Involved in cell redox homeostasis.	Involvement of a glycerol-3-phosphate dehydrogenase in modulating the NADH/NAD+ ratio provides evidence of a mitochondrial glycerol-3-phosphate shuttle in Arabidopsis.2006 · DOI: 10.1105/tpc.105.039750
`At3g07690`	Required for glycerol-3-phosphate (G3P) accumulation during systemic acquired resistance (SAR) establishment.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0939600`	May be involved in cell redox homeostasis.	No verified direct reference in this release
`Os01g0801600`	May be involved in cell redox homeostasis.	No verified direct reference in this release
`Os05g0495700`	May be involved in cell redox homeostasis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036230 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006072 glycerol-3-phosphate metabolic process Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0046168 glycerol-3-phosphate catabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0047952 glycerol-3-phosphate dehydrogenase [NAD(P)+] activity Molecular Function

GO:0051287 NAD binding Molecular Function

GO:0141152 glycerol-3-phosphate dehydrogenase (NAD+) activity Molecular Function

KEGG gene cross-reference

ath:AT2G41540

ath:AT3G07690

dosa:Os01g0801600

dosa:Os01g0939600

dosa:Os05g0495700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.587

Rank 1 · LXL04_036230 · OH-1004

Nucleus0.315

Rank 2 · LXL04_036230 · OH-1004

Mitochondrion0.099

Rank 3 · LXL04_036230 · OH-1004

Cell membrane0.098

Rank 4 · LXL04_036230 · OH-1004

Lysosome / Vacuole0.074

Rank 5 · LXL04_036230 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01210.30NAD_Gly3P_dh_N147-248 aa

PF07479.20NAD_Gly3P_dh_C275-424 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036230	`PF01210.30`	NAD_Gly3P_dh_N	147	248	3.8e-15	56.9
LXL04_036230	`PF07479.20`	NAD_Gly3P_dh_C	275	424	7e-18	65.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22216`	Arabidopsis thaliana	Glycerol-3-phosphate dehydrogenase [NAD(+)] GPDHC1, cytosolic	84.516%	Swiss-Prot	strong database homology
`Q9S785`	Arabidopsis thaliana	Glycerol-3-phosphate dehydrogenase [NAD(+)] At3g07690, cytosolic	80.182%	Swiss-Prot	strong database homology
`Q8S0G4`	Oryza sativa subsp. japonica	Probable glycerol-3-phosphate dehydrogenase [NAD(+)] 1, cytosolic	85.307%	Swiss-Prot	strong database homology
`Q8S2G5`	Oryza sativa subsp. japonica	Probable glycerol-3-phosphate dehydrogenase [NAD(+)] 2, cytosolic	82.247%	Swiss-Prot	strong database homology
`Q65X70`	Oryza sativa subsp. japonica	Probable glycerol-3-phosphate dehydrogenase [NAD(+)] 3, cytosolic	81.922%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card