TkA04G000450 | RubberDandelionOmics

Gene overview

TkA04G000450

Reference: TK1151 Chr: Chr04 Coordinates: 112247-119437 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1515 bp · TkA04G000450|TK1151|cDNA

TTTTACGACCAATATGTTTTACTAAATTATAACGTTGCCGGTGAGTTGAATCTTTTTGTGTAAAGGAGTCGATACTATTAAACCGAGAGAATGAAGCTACAGATTTAGAGGAGGAAGCAGATAAGATGACATATCTCACAGACGTTGGTTCTCTCAACTGTTACCGTAGCTGGCCTTCCCTTCCGGCACCAGGTACTGTAGGCGCGTTGACGTCAAAGAATCCTAGATACCTCATCACCTATGGTCCAGCGCACCGCAAG...

CDS

Download CDS FASTA

1890 bp · TkA04G000450|TK1151|CDS

ATGACATATCTCACAGACGTTGGTTCTCTCAACTGTTACCGTAGCTGGCCTTCCCTTCCGGCACCAGGTACTGTAGGCGCGTTGACGTCAAAGAATCCTAGATACCTCATCACCTATGGTCCAGCGCACCGCAAGTGCAGCAGCTGGAGGTTCCGCTGTTCTATAGCCAAGGATTCCCCAATTACTCCTCCAATTTCAAACGAGTCCAATTCTCAGCCATTGCTGGACTGTGTCATTGTGGGGGCCGGCATTAGCGGCCT...

Protein

Download Protein FASTA

629 aa · TkA04G000450|TK1151|PROTEIN

MTYLTDVGSLNCYRSWPSLPAPGTVGALTSKNPRYLITYGPAHRKCSSWRFRCSIAKDSPITPPISNESNSQPLLDCVIVGAGISGLCIAQALATKHAAVSPDVIVTEARDRVGGNISTVERDGYLWEEGPNSFQPSDAMLTMVVDSGLKDDLVLGDPTAPRFVLWGGDLKPVPSKPADLPFFDLMSFPGKLRAGFGAFGFRPSPPDREESVEEFVRRNLGDEVFERLIEPFCSGVYAGDPSKLSMKAAFGKVWKLEQNG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G000450`
TK1151 ID	TkA04G000450
OH-1004 ID	LXL04_006054
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	29.800
Protein coverage (%)	TK1151 60.890 / OH-1004 47.942 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G000450

Location Chr04:112247-119437 (+)

Description Similar to PPXII: Protoporphyrinogen oxidase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g01690`	Catalyzes the 6-electron oxidation of protoporphyrinogen-IX to form protoporphyrin-IX.	No verified direct reference in this release
`At5g14220`	Catalyzes the 6-electron oxidation of protoporphyrinogen-IX to form protoporphyrin-IX.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0286600`	Catalyzes the 6-electron oxidation of protoporphyrinogen-IX to form protoporphyrin-IX.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006054 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006779 porphyrin-containing compound biosynthetic process Biological Process

GO:0006782 protoporphyrinogen IX biosynthetic process Biological Process

GO:0006783 heme biosynthetic process Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0015995 chlorophyll biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT5G14220

nta:107815753

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.973

Rank 1 · TkA04G000450 · TK1151

Mitochondrion0.040

Rank 2 · TkA04G000450 · TK1151

Cytoplasm0.019

Rank 3 · TkA04G000450 · TK1151

Peroxisome0.014

Rank 4 · TkA04G000450 · TK1151

Cell membrane0.012

Rank 5 · TkA04G000450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01266DAO76-115 aa

PF01946Thi476-116 aa

PF12831FAD_oxidored76-118 aa

PF13454NAD_binding_978-117 aa

PF13450NAD_binding_879-138 aa

PF01593Amino_oxidase84-451 aa

PF13454NAD_binding_9310-355 aa

PF01593Amino_oxidase530-619 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G000450	`PF01266`	DAO	76	115	0.00017	22.0
TkA04G000450	`PF01946`	Thi4	76	116	0.054	13.4
TkA04G000450	`PF12831`	FAD_oxidored	76	118	0.19	11.7
TkA04G000450	`PF13454`	NAD_binding_9	78	117	0.0083	16.8
TkA04G000450	`PF13450`	NAD_binding_8	79	138	8.7e-12	45.9
TkA04G000450	`PF01593`	Amino_oxidase	84	451	6.5e-88	296.7
TkA04G000450	`PF13454`	NAD_binding_9	310	355	0.0083	16.8
TkA04G000450	`PF01593`	Amino_oxidase	530	619	6.5e-88	296.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P55826`	Arabidopsis thaliana	sp\|P55826\|PPOC_ARATH Protoporphyrinogen oxidase 1, chloroplastic	76.300%	Swiss-Prot	High
`Q8S9J1`	Arabidopsis thaliana	sp\|Q8S9J1\|PPOCM_ARATH Protoporphyrinogen oxidase 2, chloroplastic/mitochondrial	29.000%	Swiss-Prot	Low
`Q9AR38`	Oryza sativa subsp. japonica	sp\|Q9AR38\|PPOC_ORYSJ Protoporphyrinogen oxidase, chloroplastic	72.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card