LXL04_006054 | RubberDandelionOmics

Gene overview

LXL04_006054

Reference: OH-1004 Chr: Chr02 Coordinates: 1153678-1160247 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2262 bp · LXL04_006054|LXL04_006054|OH1004|cDNA

ATGGCGGTTTCAATTAAGCGTGCAGTGATATCGTGTCGCAACATCTATCCTTTGCTACGATCATCTCGCCGGATTTCTCAATGTGCAGCCTCTCCATATTTCCTGAAAACAGTCAGTGATCCGCGTCCGGTGTTTTCCAGTTCGCCGGCGATTGGTTTTCCATTCGAATCTCGCAGATCATTTGCCAAAGCACGAAAGAAATGGGATGACGATGACACTGGCGAACTTGATGTTGCTAACGGCGATGCTGCGAGCAGAAT...

CDS

Download CDS FASTA

2262 bp · LXL04_006054|LXL04_006054|OH1004|CDS

ATGGCGGTTTCAATTAAGCGTGCAGTGATATCGTGTCGCAACATCTATCCTTTGCTACGATCATCTCGCCGGATTTCTCAATGTGCAGCCTCTCCATATTTCCTGAAAACAGTCAGTGATCCGCGTCCGGTGTTTTCCAGTTCGCCGGCGATTGGTTTTCCATTCGAATCTCGCAGATCATTTGCCAAAGCACGAAAGAAATGGGATGACGATGACACTGGCGAACTTGATGTTGCTAACGGCGATGCTGCGAGCAGAAT...

Protein

Download Protein FASTA

753 aa · LXL04_006054|LXL04_006054|OH1004|PROTEIN

MAVSIKRAVISCRNIYPLLRSSRRISQCAASPYFLKTVSDPRPVFSSSPAIGFPFESRRSFAKARKKWDDDDTGELDVANGDAASRIEIVNIGPIIKSTAISEMEAAIDAVSHELSKLRTGRASAGMLDHIIVETGGVKMPLNRMAVVSVLDPKTLSVTPYSSNALKELEKAIVSSPLGLNPKPDGERLITAIPPMTKEHMQAVCKVVAKSSEDAKQRIRRARQKAIDTIKKSLPKKSEGKNKGKDKENVKANKTVSGFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006054`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006054

Location Chr02:1153678-1160247 (-)

Description Similar to PPXII: Protoporphyrinogen oxidase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g14220`	Catalyzes the 6-electron oxidation of protoporphyrinogen-IX to form protoporphyrin-IX.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006054 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006779 porphyrin-containing compound biosynthetic process Biological Process

GO:0006782 protoporphyrinogen IX biosynthetic process Biological Process

GO:0006783 heme biosynthetic process Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0015995 chlorophyll biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT5G14220

nta:107815753

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.758

Rank 1 · LXL04_006054 · OH-1004

Plastid0.163

Rank 2 · LXL04_006054 · OH-1004

Cytoplasm0.104

Rank 3 · LXL04_006054 · OH-1004

Peroxisome0.049

Rank 4 · LXL04_006054 · OH-1004

Nucleus0.046

Rank 5 · LXL04_006054 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01765.25RRF112-293 aa

PF01266.31DAO300-334 aa

PF13450.13NAD_binding_8303-368 aa

PF01593.31Amino_oxidase308-744 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006054	`PF01765.25`	RRF	112	293	3.7e-45	154.4
LXL04_006054	`PF01266.31`	DAO	300	334	6.7e-08	33.2
LXL04_006054	`PF13450.13`	NAD_binding_8	303	368	1.2e-13	51.8
LXL04_006054	`PF01593.31`	Amino_oxidase	308	744	2.7e-74	251.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S9J1`	Arabidopsis thaliana	Protoporphyrinogen oxidase 2, chloroplastic/mitochondrial	62.955%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card