RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G522050
Reference: TK1151 Chr: Chr03 Coordinates: 130991952-130995857 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2587 bp · TkA03G522050|TK1151|cDNA

ATGACATATTACAATCACATAATGCCTTTATTTTGTATCCTTATGTTTGAGTTAGGCTTATCAAACCCAAAATGACAAAACCCTACGCATCACAAATTTAAATTATATTTTATTCAATTTCTATGACTTATGAGCATCATCAACTGCAACACCATCAAATGTCTGTCGGAGTTTCTTCTTCACCATTTCCACTCCACTTCTCCATCTCTAACTCCACCATATCCACTCCTCTACCACCTTCAAACTACCTCTTGAACTCC...

CDS

Download CDS FASTA

2043 bp · TkA03G522050|TK1151|CDS

ATGAATCATAATTCTTCGTTTTTCATTACAACGCTGTTGATTACAGCTTTCTTCTTCACGTTATCGGAATCATCAACCTGCAACAATACCGACTATGTTCTAATCTCGAAGGCGTTCATGTCGGTTGATAATTTTAATTCTTCATGGTTCGTATGTTCAAAGTCGCAAATCTCGAAGATTAATTTGTCGTCGAGAAATCTCACCGGAGCTATTTCGTGGAAGTTTTTTAAGAACTTGACTCACATCCACACGATTAACCT...

Protein

Download Protein FASTA

680 aa · TkA03G522050|TK1151|PROTEIN

MNHNSSFFITTLLITAFFFTLSESSTCNNTDYVLISKAFMSVDNFNSSWFVCSKSQISKINLSSRNLTGAISWKFFKNLTHIHTINLSNNALKGYIPAWFWSIPNLVEVNLSKNKLGGAIGFESGSGLSSIQVLNLSFNRFTNLAHLSNFSNLSVLDMSYNNLKVLPFGLNSLKNLQHLDLSSCNISGDLKPISNLTSLEFLDVANNHMSGSFPKDFPPFSNINFLNISFNNFTGELPYEKVRRFGNSSFINTGMLFKFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G522050
TK1151 IDTkA03G522050
OH-1004 IDLXL04_010356
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)96.300
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G522050
LocationChr03:130991952-130995857 (+)
DescriptionSimilar to CAMRLK: Calmodulin-binding receptor kinase CaMRLK
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g45800 Can phosphorylate the myelin basic protein in vitro.
A receptor-like kinase from Arabidopsis thaliana is a calmodulin-binding protein.2004 · DOI: 10.1042/bj20031045
At2g24230 Probable LRR receptor-like serine/threonine-protein kinase At2g24230. No verified direct reference in this release
At5g58150 Probably inactive leucine-rich repeat receptor-like protein kinase At5g58150. No verified direct reference in this release
At5g07280 Receptor with a serine/threonine-protein kinase activity required for the specification of the correct number of male archesporial initials and for the subsequent specification of tapetal and middle cell layer identities. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os09g0293500 May be involved in brassenosteroid (BR) perception in roots.
The role of OsBRI1 and its homologous genes, OsBRL1 and OsBRL3, in rice.2006 · DOI: 10.1104/pp.105.072330
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_010356 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006970 response to osmotic stress Biological Process
GO:0009556 microsporogenesis Biological Process
GO:0009625 response to insect Biological Process
GO:0009733 response to auxin Biological Process
GO:0009793 embryo development ending in seed dormancy Biological Process
GO:0010234 anther wall tapetum cell fate specification Biological Process
GO:0045088 regulation of innate immune response Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:0000325 plant-type vacuole Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0016020 membrane Cellular Component
GO:0004672 protein kinase activity Molecular Function
KEGG gene cross-reference
ath:AT2G24230
ath:AT5G07280
ath:AT5G45800
ath:AT5G58150
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.862
Rank 1 · TkA03G522050 · TK1151
Endoplasmic reticulum0.085
Rank 2 · TkA03G522050 · TK1151
Cytoplasm0.075
Rank 3 · TkA03G522050 · TK1151
Nucleus0.060
Rank 4 · TkA03G522050 · TK1151
Lysosome / Vacuole0.025
Rank 5 · TkA03G522050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09716ETRAMP6-43 aa
PF14580LRR_956-146 aa
PF13855LRR_857-116 aa
PF00560LRR_158-73 aa
PF12799LRR_459-91 aa
PF23598LRR_1471-111 aa
PF25019LRR_R13L1-DRL2177-112 aa
PF23952LRR_EndoS77-114 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G522050PF09716ETRAMP6430.5211.1
TkA03G522050PF14580LRR_9561460.6110.3
TkA03G522050PF13855LRR_8571166.6e-1864.9
TkA03G522050PF00560LRR_158731.9e-1245.4
TkA03G522050PF12799LRR_459911.1e-1661.2
TkA03G522050PF23598LRR_14711111.6e-0524.6
TkA03G522050PF25019LRR_R13L1-DRL21771120.001319.3
TkA03G522050PF23952LRR_EndoS771140.0614.3
TkA03G522050PF23286LRR_13782050.1112.9
TkA03G522050PF13516LRR_679920.0001722.1
TkA03G522050PF00560LRR_1821021.9e-1245.4
TkA03G522050PF25019LRR_R13L1-DRL21961130.001319.3
TkA03G522050PF12799LRR_41041491.1e-1661.2
TkA03G522050PF13516LRR_61041190.0001722.1
TkA03G522050PF00560LRR_11051191.9e-1245.4
TkA03G522050PF23952LRR_EndoS1231610.0614.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FK63Arabidopsis thalianasp|Q9FK63|CARLK_ARATH Calmodulin-binding receptor kinase CaMRLK50.300%Swiss-ProtHigh
C0LGK9Arabidopsis thalianasp|C0LGK9|Y2242_ARATH Probable LRR receptor-like serine/threonine-protein kinase At2g2423042.600%Swiss-ProtLow
Q9LVN2Arabidopsis thalianasp|Q9LVN2|Y5815_ARATH Probably inactive leucine-rich repeat receptor-like protein kinase At5g5815038.200%Swiss-ProtLow
Q9LYN8Arabidopsis thalianasp|Q9LYN8|EMS1_ARATH Leucine-rich repeat receptor protein kinase EMS137.000%Swiss-ProtLow
Q69JN6Oryza sativa subsp. japonicasp|Q69JN6|BRL1_ORYSJ Brassinosteroid LRR receptor kinase BRL134.700%Swiss-ProtLow

JBrowse

View in Genome Browser