LXL04_010356 | RubberDandelionOmics

Gene overview

LXL04_010356

Reference: OH-1004 Chr: Chr02 Coordinates: 145044810-145048175 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2043 bp · LXL04_010356|LXL04_010356|OH1004|cDNA

ATGAATCTTAATTCTTCGTTTTTCATTACAACGCTGTTGATTACAGCTTTCTTCTTCACGTTATCGGAATCATCAACCTGCAACAACACAGACTATGTTCTAATCTCGAAGGCGTTCATGTCGGTTGACAATTTTAATTCTTCATGGTTCGTGTGTTCAAAGTCGCAAATCTCGGAGATTGATTTGTCGTCGAGAAATCTCACCGGAGCTATTTCGTGGAAGTTTTTTAAGAACTTGACTCACATCCATACCATTAATCT...

CDS

Download CDS FASTA

2043 bp · LXL04_010356|LXL04_010356|OH1004|CDS

ATGAATCTTAATTCTTCGTTTTTCATTACAACGCTGTTGATTACAGCTTTCTTCTTCACGTTATCGGAATCATCAACCTGCAACAACACAGACTATGTTCTAATCTCGAAGGCGTTCATGTCGGTTGACAATTTTAATTCTTCATGGTTCGTGTGTTCAAAGTCGCAAATCTCGGAGATTGATTTGTCGTCGAGAAATCTCACCGGAGCTATTTCGTGGAAGTTTTTTAAGAACTTGACTCACATCCATACCATTAATCT...

Protein

Download Protein FASTA

680 aa · LXL04_010356|LXL04_010356|OH1004|PROTEIN

MNLNSSFFITTLLITAFFFTLSESSTCNNTDYVLISKAFMSVDNFNSSWFVCSKSQISEIDLSSRNLTGAISWKFFKNLTHIHTINLSNNAFKGYIPAWFWSIPNLVEVNLSKNKLGGAIGFESGSGLSSIQVLNLSFNRFTNLAHLSNFSNLSVLDMSYNNLKVLPFGLNSLKNLQHLDLSSCNISGDLNPISNLTSLEFLDVANNHMSGSFPKDFPPFSNINFLNISFNNFTGELPYEKVRRFGNSSFINTGMLFKFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010356`
TK1151 ID	TkA03G522050
OH-1004 ID	LXL04_010356
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010356

Location Chr02:145044810-145048175 (+)

Description Similar to CAMRLK: Calmodulin-binding receptor kinase CaMRLK

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g45800`	Can phosphorylate the myelin basic protein in vitro.	A receptor-like kinase from Arabidopsis thaliana is a calmodulin-binding protein.2004 · DOI: 10.1042/bj20031045
`At2g24230`	Probable LRR receptor-like serine/threonine-protein kinase At2g24230.	No verified direct reference in this release
`At5g58150`	Probably inactive leucine-rich repeat receptor-like protein kinase At5g58150.	No verified direct reference in this release
`At5g07280`	Receptor with a serine/threonine-protein kinase activity required for the specification of the correct number of male archesporial initials and for the subsequent specification of tapetal and middle cell layer identities.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0917500`	Receptor-like kinase that plays important roles in restricting the number of cells entering into male and female sporogenesis.	The MSP1 gene is necessary to restrict the number of cells entering into male and female sporogenesis and to initiate anther wall formation in rice.2003 · DOI: 10.1105/tpc.012401

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010356 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009556 microsporogenesis Biological Process

GO:0009625 response to insect Biological Process

GO:0009733 response to auxin Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010234 anther wall tapetum cell fate specification Biological Process

GO:0045088 regulation of innate immune response Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G24230

ath:AT5G07280

ath:AT5G45800

ath:AT5G58150

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.856

Rank 1 · LXL04_010356 · OH-1004

Endoplasmic reticulum0.088

Rank 2 · LXL04_010356 · OH-1004

Cytoplasm0.076

Rank 3 · LXL04_010356 · OH-1004

Nucleus0.062

Rank 4 · LXL04_010356 · OH-1004

Lysosome / Vacuole0.026

Rank 5 · LXL04_010356 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13855.13LRR_857-116 aa

PF12799.14LRR_4104-149 aa

PF13855.13LRR_8130-186 aa

PF12799.14LRR_4152-195 aa

PF00069.32Pkinase412-583 aa

PF07714.24PK_Tyr_Ser-Thr413-580 aa

PF07714.24PK_Tyr_Ser-Thr584-667 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010356	`PF13855.13`	LRR_8	57	116	1.2e-17	64.1
LXL04_010356	`PF12799.14`	LRR_4	104	149	3.6e-18	65.9
LXL04_010356	`PF13855.13`	LRR_8	130	186	1.2e-17	64.1
LXL04_010356	`PF12799.14`	LRR_4	152	195	3.6e-18	65.9
LXL04_010356	`PF00069.32`	Pkinase	412	583	1.8e-16	61.1
LXL04_010356	`PF07714.24`	PK_Tyr_Ser-Thr	413	580	2.2e-27	96.7
LXL04_010356	`PF07714.24`	PK_Tyr_Ser-Thr	584	667	2.2e-27	96.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FK63`	Arabidopsis thaliana	Calmodulin-binding receptor kinase CaMRLK	51.813%	Swiss-Prot	strong database homology
`C0LGK9`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At2g24230	33.090%	Swiss-Prot	moderate database homology
`Q9LVN2`	Arabidopsis thaliana	Probably inactive leucine-rich repeat receptor-like protein kinase At5g58150	31.825%	Swiss-Prot	moderate database homology
`Q9LYN8`	Arabidopsis thaliana	Leucine-rich repeat receptor protein kinase EMS1	30.967%	Swiss-Prot	moderate database homology
`Q8RZV7`	Oryza sativa subsp. japonica	Leucine-rich repeat receptor protein kinase MSP1	30.285%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card