RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G518260
Reference: TK1151 Chr: Chr03 Coordinates: 130002456-130004669 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1664 bp · TkA03G518260|TK1151|cDNA

GAAACTGAAACCTTCGCACATGATTAGAGCACAATATGGAGCCACGAAGCCAAAATTAAAAATGCCACCACGTTTAAGAGCCCAGCCAATGAAATGAAATCTATCCTCTTATCCATATAGCCCTAAAAACCAGTAGACAAACACACTGATCAATCCACCAATGCTATTCCTACTCGTTTAAACCTTCAACATACTCGTAAACAACCATGGCTGGATTACTAGGAACTTCTTCTGCAGCAGCAGCACTACTGAGCTCTCGA...

CDS

Download CDS FASTA

1275 bp · TkA03G518260|TK1151|CDS

ATGGCTGGATTACTAGGAACTTCTTCTGCAGCAGCAGCACTACTGAGCTCTCGATCAATTTCTTCGTCCTCTTCGTCAAAGGCCTCAATTCCTGCTTTATCCTTTAATCCAGTGCATAATCAAGGCCGAAGGTTTTACGGAGGTATAGGACTTCCATCAAAGAAAGGAAGGTCCCATTTCTCGATCTCAAATGTCGCCACCGAACTCAGCCCAGCCCAAGAACAGGCACAAAAACTCTCAAAAGAAAACCAAAGACCCGT...

Protein

Download Protein FASTA

424 aa · TkA03G518260|TK1151|PROTEIN

MAGLLGTSSAAAALLSSRSISSSSSSKASIPALSFNPVHNQGRRFYGGIGLPSKKGRSHFSISNVATELSPAQEQAQKLSKENQRPVYPFAAIVGQDEMKLCLLLNVIDPKIGGVMIMGDRGTGKSTTVRSLVDLLPEITVVQSDPFNSDPSDPESMGMEVREKLIKGEQLPTLKVKINMVDLPLGATEDRVCGTIDIEKALTEGVKAFEPGLLAKANRGILYVDEVNLLDDHLVDVLLDSAASGWNTVEREGISISHPA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G518260
TK1151 IDTkA03G518260
OH-1004 IDLXL04_010303
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G518260
LocationChr03:130002456-130004669 (-)
DescriptionSimilar to CHLI: Magnesium-chelatase subunit ChlI, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g18480 Involved in chlorophyll biosynthesis.
Chlorophyll biosynthesis. Expression of a second chl I gene of magnesium chelatase in Arabidopsis supports only limited chlorophyll synthesis.2002 · DOI: 10.1104/pp.010625
An Arabidopsis mutant that is resistant to the protoporphyrinogen oxidase inhibitor acifluorfen shows regulatory changes in tetrapyrrole biosynthesis.2005 · DOI: 10.1007/s00438-005-1129-6
The CHLI1 subunit of Arabidopsis thaliana magnesium chelatase is a target protein of the chloroplast thioredoxin.2007 · DOI: 10.1074/jbc.m703324200
Functional analysis of Arabidopsis thaliana isoforms of the Mg-chelatase CHLI subunit.2008 · DOI: 10.1039/b802604c
Roles of the different components of magnesium chelatase in abscisic acid signal transduction.2012 · DOI: 10.1007/s11103-012-9965-3
Mg-chelatase I subunit 1 and Mg-protoporphyrin IX methyltransferase affect the stomatal aperture in Arabidopsis thaliana.2014 · DOI: 10.1007/s10265-014-0636-0
At5g45930 Involved in chlorophyll biosynthesis.
Functional analysis of Arabidopsis thaliana isoforms of the Mg-chelatase CHLI subunit.2008 · DOI: 10.1039/b802604c
Arabidopsis CHLI2 can substitute for CHLI1.2009 · DOI: 10.1104/pp.109.135368

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0563300 Involved in chlorophyll biosynthesis.
Rice Chlorina-1 and Chlorina-9 encode ChlD and ChlI subunits of Mg-chelatase, a key enzyme for chlorophyll synthesis and chloroplast development.2006 · DOI: 10.1007/s11103-006-9024-z
C-terminal residues of oryza sativa GUN4 are required for the activation of the ChlH subunit of magnesium chelatase in chlorophyll synthesis.2012 · DOI: 10.1016/j.febslet.2011.12.026
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_010303 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0015979 photosynthesis Biological Process
GO:0015995 chlorophyll biosynthetic process Biological Process
GO:0005829 cytosol Cellular Component
GO:0009505 plant-type cell wall Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0009536 plastid Cellular Component
GO:0009570 chloroplast stroma Cellular Component
GO:0010007 magnesium chelatase complex Cellular Component
GO:0005524 ATP binding Molecular Function
GO:0016851 magnesium chelatase activity Molecular Function
GO:0016887 ATP hydrolysis activity Molecular Function
KEGG gene cross-reference
ath:AT4G18480
ath:AT5G45930
dosa:Os03g0563300
gmx:100784256
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.883
Rank 1 · TkA03G518260 · TK1151
Mitochondrion0.137
Rank 2 · TkA03G518260 · TK1151
Nucleus0.032
Rank 3 · TkA03G518260 · TK1151
Cytoplasm0.021
Rank 4 · TkA03G518260 · TK1151
Cell membrane0.009
Rank 5 · TkA03G518260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00735Septin55-109 aa
PF03193RsgA_GTPase69-134 aa
PF01078Mg_chelatase91-141 aa
PF20030bpMoxR93-136 aa
PF12775AAA_796-143 aa
PF13191AAA_16104-147 aa
PF13555AAA_29109-135 aa
PF07728AAA_5114-136 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G518260PF00735Septin551090.02714.5
TkA03G518260PF03193RsgA_GTPase691340.1512.5
TkA03G518260PF01078Mg_chelatase911412.1e-1144.3
TkA03G518260PF20030bpMoxR931360.0006119.6
TkA03G518260PF12775AAA_7961430.0314.6
TkA03G518260PF13191AAA_161041470.0004721.4
TkA03G518260PF13555AAA_291091350.06913.6
TkA03G518260PF07728AAA_51141364.5e-0730.7
TkA03G518260PF00158Sigma54_activat1141320.0007719.9
TkA03G518260PF05673DUF8151141340.03214.1
TkA03G518260PF00493MCM1151392.4e-0627.6
TkA03G518260PF13401AAA_221152662.1e-0525.5
TkA03G518260PF00004AAA1152890.02515.7
TkA03G518260PF00735Septin1151840.02714.5
TkA03G518260PF13173AAA_141151450.1612.7
TkA03G518260PF13671AAA_331151460.2112.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
P16127Arabidopsis thalianasp|P16127|CHLI1_ARATH Magnesium-chelatase subunit ChlI-1, chloroplastic77.000%Swiss-ProtHigh
Q5XF33Arabidopsis thalianasp|Q5XF33|CHLI2_ARATH Magnesium-chelatase subunit ChlI-2, chloroplastic80.600%Swiss-ProtHigh
Q53RM0Oryza sativa subsp. japonicasp|Q53RM0|CHLI_ORYSJ Magnesium-chelatase subunit ChlI, chloroplastic83.500%Swiss-ProtHigh

JBrowse

View in Genome Browser