LXL04_010303 | RubberDandelionOmics

Gene overview

LXL04_010303

Reference: OH-1004 Chr: Chr02 Coordinates: 143903668-143905449 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1275 bp · LXL04_010303|LXL04_010303|OH1004|cDNA

ATGGCTGGGTTACTAGGAACTTCTTCTGCAGCAGCAGCACTACTGAGCTCTCGATCaatttcttcttcctcttcgtCAAAGGCCTCAATTCCTGCTTTATCCTTTAATCCAGTGCATAATCAAGGCCGAAGGTTTTACGGAGGTATAGGACTTCCATCAAAGAAAGGAAGGTCCCATTTCTCGATCTCAAATGTCGCCACCGAACTCAGCCCAGCCCAAGAACAGGCACAAAAACTCTCAAAAGAAAACCAAAGACCCGT...

CDS

Download CDS FASTA

1275 bp · LXL04_010303|LXL04_010303|OH1004|CDS

ATGGCTGGGTTACTAGGAACTTCTTCTGCAGCAGCAGCACTACTGAGCTCTCGATCAATTTCTTCTTCCTCTTCGTCAAAGGCCTCAATTCCTGCTTTATCCTTTAATCCAGTGCATAATCAAGGCCGAAGGTTTTACGGAGGTATAGGACTTCCATCAAAGAAAGGAAGGTCCCATTTCTCGATCTCAAATGTCGCCACCGAACTCAGCCCAGCCCAAGAACAGGCACAAAAACTCTCAAAAGAAAACCAAAGACCCGT...

Protein

Download Protein FASTA

424 aa · LXL04_010303|LXL04_010303|OH1004|PROTEIN

MAGLLGTSSAAAALLSSRSISSSSSSKASIPALSFNPVHNQGRRFYGGIGLPSKKGRSHFSISNVATELSPAQEQAQKLSKENQRPVYPFAAIVGQDEMKLCLLLNVIDPKIGGVMIMGDRGTGKSTTVRSLVDLLPEITVVQSDPFNSDPSDPESMGMEVREKLIKGEQLPTLKVKINMVDLPLGATEDRVCGTIDIEKALTEGVKAFEPGLLAKANRGILYVDEVNLLDDHLVDVLLDSAASGWNTVEREGISISHPA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010303`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010303

Location Chr02:143903668-143905449 (-)

Description Similar to CHLI: Magnesium-chelatase subunit ChlI, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18480`	Involved in chlorophyll biosynthesis.	Chlorophyll biosynthesis. Expression of a second chl I gene of magnesium chelatase in Arabidopsis supports only limited chlorophyll synthesis.2002 · DOI: 10.1104/pp.010625 An Arabidopsis mutant that is resistant to the protoporphyrinogen oxidase inhibitor acifluorfen shows regulatory changes in tetrapyrrole biosynthesis.2005 · DOI: 10.1007/s00438-005-1129-6 The CHLI1 subunit of Arabidopsis thaliana magnesium chelatase is a target protein of the chloroplast thioredoxin.2007 · DOI: 10.1074/jbc.m703324200 Functional analysis of Arabidopsis thaliana isoforms of the Mg-chelatase CHLI subunit.2008 · DOI: 10.1039/b802604c Roles of the different components of magnesium chelatase in abscisic acid signal transduction.2012 · DOI: 10.1007/s11103-012-9965-3 Mg-chelatase I subunit 1 and Mg-protoporphyrin IX methyltransferase affect the stomatal aperture in Arabidopsis thaliana.2014 · DOI: 10.1007/s10265-014-0636-0
`At5g45930`	Involved in chlorophyll biosynthesis.	Functional analysis of Arabidopsis thaliana isoforms of the Mg-chelatase CHLI subunit.2008 · DOI: 10.1039/b802604c Arabidopsis CHLI2 can substitute for CHLI1.2009 · DOI: 10.1104/pp.109.135368

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0563300`	Involved in chlorophyll biosynthesis.	Rice Chlorina-1 and Chlorina-9 encode ChlD and ChlI subunits of Mg-chelatase, a key enzyme for chlorophyll synthesis and chloroplast development.2006 · DOI: 10.1007/s11103-006-9024-z C-terminal residues of oryza sativa GUN4 are required for the activation of the ChlH subunit of magnesium chelatase in chlorophyll synthesis.2012 · DOI: 10.1016/j.febslet.2011.12.026

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010303 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015979 photosynthesis Biological Process

GO:0015995 chlorophyll biosynthetic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0010007 magnesium chelatase complex Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016851 magnesium chelatase activity Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

KEGG gene cross-reference

ath:AT4G18480

ath:AT5G45930

dosa:Os03g0563300

gmx:100784256

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.883

Rank 1 · LXL04_010303 · OH-1004

Mitochondrion0.137

Rank 2 · LXL04_010303 · OH-1004

Nucleus0.032

Rank 3 · LXL04_010303 · OH-1004

Cytoplasm0.021

Rank 4 · LXL04_010303 · OH-1004

Cell membrane0.009

Rank 5 · LXL04_010303 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01078.28Mg_chelatase200-270 aa

PF00493.30MCM200-275 aa

PF17863.8AAA_lid_2350-408 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010303	`PF01078.28`	Mg_chelatase	200	270	2.1e-11	44.3
LXL04_010303	`PF00493.30`	MCM	200	275	2.4e-06	27.6
LXL04_010303	`PF17863.8`	AAA_lid_2	350	408	3.8e-20	72.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P16127`	Arabidopsis thaliana	Magnesium-chelatase subunit ChlI-1, chloroplastic	77.986%	Swiss-Prot	strong database homology
`Q5XF33`	Arabidopsis thaliana	Magnesium-chelatase subunit ChlI-2, chloroplastic	77.986%	Swiss-Prot	strong database homology
`Q53RM0`	Oryza sativa subsp. japonica	Magnesium-chelatase subunit ChlI, chloroplastic	84.890%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card