RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G352970
Reference: TK1151 Chr: Chr03 Coordinates: 86949303-86952102 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1780 bp · TkA03G352970|TK1151|cDNA

TCATAGCTTACATAGCACAACACCACTCACTAAACCCCACCATTCGCTTCTCTTCCCTCTGTCTTGACTGTCTTTGTGTAAAAGCGTATTCGCTACACCTGCTTTAAATTTGAATCCTTTTTATGTTCCAATTTATGGCACCCATTTGAAAAAAAGGGAATCATCGTTCTTACACCAACAAACCTAAATGGGTACGAATTTGGTATTGATTTGGGTTTTCTCAGCTGTTTTTGTAGCAACTATCCTTTTCAGCACATGTT...

CDS

Download CDS FASTA

888 bp · TkA03G352970|TK1151|CDS

ATGAAAGGAGCACTATTAATCGCTTTAATGACTGCTTTAGGCCTGGCAGTTGTGCTCTTTGTATTCCTTCTGGTTTTTATGCTCTCAAAGAAAGAACGCGCGGCAAAAAAATACGTAGTTGTCAAAAAACAAGTTCATCAAGAAACAAGCACACAACTTATAACATTCCATGGCGACCTTCCATACCCATCAAGCGAAATCATAGAAAAGCTCGAGTCTCTTGATGACGAACATGTCGTTGGCGCCGGTGGATTTGGGAC...

Protein

Download Protein FASTA

296 aa · TkA03G352970|TK1151|PROTEIN

MKGALLIALMTALGLAVVLFVFLLVFMLSKKERAAKKYVVVKKQVHQETSTQLITFHGDLPYPSSEIIEKLESLDDEHVVGAGGFGTVYRMVMNDCGTFAVKRIERSREGRDQAFERELEILGSVKHINLVNLRGYCRFPDSKLLIYDYMAMGSLENFLHECREGDETLNWNTRLKVAYGSARGLAYLHHDCSPRIVHRDIKSSNILLDENLEPCVSDFGLAKLLVDEDAHVTTVVAGTFGYLAPEYLQSGRATVKSDVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G352970
TK1151 IDTkA03G352970
OH-1004 IDLXL04_008616
Relationship / confidenceSequence Supported Annotation Or Model Conflict / Review
Protein identity (%)98.300
Protein coverage (%)TK1151 98.311 / OH-1004 48.179
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G352970
LocationChr03:86949303-86952102 (-)
DescriptionSimilar to FEI1: LRR receptor-like serine/threonine-protein kinase FEI 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g31420 Involved in the signaling pathway that regulates cell wall function, including cellulose biosynthesis, likely via an 1- aminocyclopropane-1-carboxylic acid (ACC)-mediated signal (a precursor of ethylene).
Two leucine-rich repeat receptor kinases mediate signaling, linking cell wall biosynthesis and ACC synthase in Arabidopsis.2008 · DOI: 10.1105/tpc.108.063354
At2g35620 Involved in the signaling pathway that regulates cell wall function, including cellulose biosynthesis, likely via an 1- aminocyclopropane-1-carboxylic acid (ACC)-mediated signal (a precursor of ethylene).
Two leucine-rich repeat receptor kinases mediate signaling, linking cell wall biosynthesis and ACC synthase in Arabidopsis.2008 · DOI: 10.1105/tpc.108.063354
At1g78530 Receptor-like serine/threonine-protein kinase At1g78530. No verified direct reference in this release
At5g07280 Receptor with a serine/threonine-protein kinase activity required for the specification of the correct number of male archesporial initials and for the subsequent specification of tapetal and middle cell layer identities. No verified direct reference in this release
At4g39400 Receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.
Brassinosteroid-insensitive dwarf mutants of Arabidopsis accumulate brassinosteroids.1999 · DOI: 10.1104/pp.121.3.743
Brassinosteroid-insensitive-1 is a ubiquitously expressed leucine-rich repeat receptor serine/threonine kinase.2000 · DOI: 10.1104/pp.123.4.1247
The Arabidopsis transthyretin-like protein is a potential substrate of BRASSINOSTEROID-INSENSITIVE 1.2004 · DOI: 10.1105/tpc.104.023903
The Arabidopsis thaliana brassinosteroid receptor (AtBRI1) contains a domain that functions as a guanylyl cyclase in vitro.2007 · DOI: 10.1371/journal.pone.0000449
BSKs mediate signal transduction from the receptor kinase BRI1 in Arabidopsis.2008 · DOI: 10.1126/science.1156973
Tyrosine phosphorylation of the BRI1 receptor kinase emerges as a component of brassinosteroid signaling in Arabidopsis.2009 · DOI: 10.1073/pnas.0810249106
BSKs are partially redundant positive regulators of brassinosteroid signaling in Arabidopsis.2013 · DOI: 10.1111/tpj.12175

Rice

Reference gene IDPossible functionPapers / DOI
Os06g0203800 Receptor kinase involved in the regulation of thermotolerance. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_008616 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0007165 signal transduction Biological Process
GO:0007639 homeostasis of number of meristem cells Biological Process
GO:0009664 plant-type cell wall organization Biological Process
GO:0009742 brassinosteroid mediated signaling pathway Biological Process
GO:0009826 unidimensional cell growth Biological Process
GO:0009832 plant-type cell wall biogenesis Biological Process
GO:0010088 phloem development Biological Process
GO:0010192 mucilage biosynthetic process Biological Process
GO:0035556 intracellular signal transduction Biological Process
GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process
GO:0048653 anther development Biological Process
GO:1901653 cellular response to peptide Biological Process
KEGG gene cross-reference
ath:AT1G31420
ath:AT2G23950
ath:AT2G35620
dosa:Os08g0174700
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.744
Rank 1 · TkA03G352970 · TK1151
Cytoplasm0.178
Rank 2 · TkA03G352970 · TK1151
Nucleus0.134
Rank 3 · TkA03G352970 · TK1151
Endoplasmic reticulum0.063
Rank 4 · TkA03G352970 · TK1151
Golgi apparatus0.033
Rank 5 · TkA03G352970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10960Holin_BhlA7-37 aa
PF07714PK_Tyr_Ser-Thr32-51 aa
PF00069Pkinase48-48 aa
PF03109ABC172-123 aa
PF00069Pkinase77-276 aa
PF07714PK_Tyr_Ser-Thr77-276 aa
PF01636APH88-122 aa
PF12633Adenyl_cycl_N98-169 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G352970PF10960Holin_BhlA7370.1412.9
TkA03G352970PF07714PK_Tyr_Ser-Thr32511.3e-42146.6
TkA03G352970PF00069Pkinase48481.6e-44153.0
TkA03G352970PF03109ABC1721230.008116.1
TkA03G352970PF00069Pkinase772761.6e-44153.0
TkA03G352970PF07714PK_Tyr_Ser-Thr772761.3e-42146.6
TkA03G352970PF01636APH881220.01615.7
TkA03G352970PF12633Adenyl_cycl_N981690.3411.6
TkA03G352970PF14531Kinase-like1512500.2211.4
TkA03G352970PF01636APH1862230.01615.7
TkA03G352970PF03109ABC11892250.008116.1
TkA03G352970PF17667Pkinase_fungal1952620.009815.4
TkA03G352970PF03109ABC12552790.008116.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
C0LGF4Arabidopsis thalianasp|C0LGF4|FEI1_ARATH LRR receptor-like serine/threonine-protein kinase FEI 166.500%Swiss-ProtHigh
C0LGL9Arabidopsis thalianasp|C0LGL9|FEI2_ARATH LRR receptor-like serine/threonine-protein kinase FEI 265.700%Swiss-ProtHigh
Q9SYM9Arabidopsis thalianasp|Q9SYM9|Y1853_ARATH Receptor-like serine/threonine-protein kinase At1g7853055.300%Swiss-ProtHigh
Q9LYN8Arabidopsis thalianasp|Q9LYN8|EMS1_ARATH Leucine-rich repeat receptor protein kinase EMS153.500%Swiss-ProtHigh
O22476Arabidopsis thalianasp|O22476|BRI1_ARATH Protein BRASSINOSTEROID INSENSITIVE 150.200%Swiss-ProtHigh
Q69SP5Oryza sativa subsp. japonicasp|Q69SP5|EREC1_ORYSJ LRR receptor-like serine/threonine-protein kinase ER140.600%Swiss-ProtMedium

JBrowse

View in Genome Browser