LXL04_008616 | RubberDandelionOmics

Gene overview

LXL04_008616

Reference: OH-1004 Chr: Chr02 Coordinates: 104310174-104313118 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1815 bp · LXL04_008616|LXL04_008616|OH1004|cDNA

ATGGGTACGAATTTGGTATTGATTTGGGTTTTCTCAGCTGTTTTTGTAGCAACTATCCTTTTCAGCACATGTTCCTTCGCCCTCACCGAAGATGGCTTAACTCTACTGGAGTTCAAACAAGCTTTGAACGATACTAAGAACGCTCTCACCGATTGGGCGAACAATGTCGAAACCCCATGTCAATGGACTGGCATTAGCTGCCATCCGAGCGACCAACGAGTTTTAGAAATAAACTTGCCGTATATGGAGCTCGGAGGGTT...

CDS

Download CDS FASTA

1815 bp · LXL04_008616|LXL04_008616|OH1004|CDS

ATGGGTACGAATTTGGTATTGATTTGGGTTTTCTCAGCTGTTTTTGTAGCAACTATCCTTTTCAGCACATGTTCCTTCGCCCTCACCGAAGATGGCTTAACTCTACTGGAGTTCAAACAAGCTTTGAACGATACTAAGAACGCTCTCACCGATTGGGCGAACAATGTCGAAACCCCATGTCAATGGACTGGCATTAGCTGCCATCCGAGCGACCAACGAGTTTTAGAAATAAACTTGCCGTATATGGAGCTCGGAGGGTT...

Protein

Download Protein FASTA

604 aa · LXL04_008616|LXL04_008616|OH1004|PROTEIN

MGTNLVLIWVFSAVFVATILFSTCSFALTEDGLTLLEFKQALNDTKNALTDWANNVETPCQWTGISCHPSDQRVLEINLPYMELGGFISPSIGKLTRLQRLALHQNSLHGQIPNEISKCVELRAMYLRANYLQGAIPSTIGNLSLLTILDLSSNTLKGAIPPSLGHLTRLKYLNLSTNFFSGEIPNFGALSNFGNNSYIGNLDLCGQQIHKPCKSSLGFPAVLPHAESDEAAVPKHSSPSMKGALLIALMTALGLAVVLF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008616`
TK1151 ID	TkA03G352970
OH-1004 ID	LXL04_008616
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.300
Protein coverage (%)	TK1151 98.311 / OH-1004 48.179 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008616

Location Chr02:104310174-104313118 (+)

Description Similar to FEI1: LRR receptor-like serine/threonine-protein kinase FEI 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31420`	Involved in the signaling pathway that regulates cell wall function, including cellulose biosynthesis, likely via an 1- aminocyclopropane-1-carboxylic acid (ACC)-mediated signal (a precursor of ethylene).	Two leucine-rich repeat receptor kinases mediate signaling, linking cell wall biosynthesis and ACC synthase in Arabidopsis.2008 · DOI: 10.1105/tpc.108.063354
`At2g35620`	Involved in the signaling pathway that regulates cell wall function, including cellulose biosynthesis, likely via an 1- aminocyclopropane-1-carboxylic acid (ACC)-mediated signal (a precursor of ethylene).	Two leucine-rich repeat receptor kinases mediate signaling, linking cell wall biosynthesis and ACC synthase in Arabidopsis.2008 · DOI: 10.1105/tpc.108.063354
`At2g23950`	May act as a receptor kinase regulating meristem homeostasis and protophloem differentiation.	CLERK is a novel receptor kinase required for sensing of root-active CLE peptides in Arabidopsis .2018 · DOI: 10.1242/dev.162354 A CLE-BAM-CIK signalling module controls root protophloem differentiation in Arabidopsis.2022 · DOI: 10.1111/nph.17791

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8BB68`	LRR receptor kinase involved in defense response.	No verified direct reference in this release
`Os08g0174700`	LRR receptor kinase involved in defense response.	Engineering OsBAK1 gene as a molecular tool to improve rice architecture for high yield.2009 · DOI: 10.1111/j.1467-7652.2009.00444.x A subset of OsSERK genes, including OsBAK1, affects normal growth and leaf development of rice.2011 · DOI: 10.1007/s10059-011-0178-4

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008616 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0007639 homeostasis of number of meristem cells Biological Process

GO:0009664 plant-type cell wall organization Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0010088 phloem development Biological Process

GO:0010192 mucilage biosynthetic process Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process

GO:0048653 anther development Biological Process

GO:1901653 cellular response to peptide Biological Process

KEGG gene cross-reference

ath:AT1G31420

ath:AT2G23950

ath:AT2G35620

dosa:Os08g0174700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.876

Rank 1 · LXL04_008616 · OH-1004

Endoplasmic reticulum0.081

Rank 2 · LXL04_008616 · OH-1004

Cytoplasm0.076

Rank 3 · LXL04_008616 · OH-1004

Nucleus0.053

Rank 4 · LXL04_008616 · OH-1004

Lysosome / Vacuole0.021

Rank 5 · LXL04_008616 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_229-67 aa

PF23598.2LRR_1491-177 aa

PF13855.13LRR_8121-178 aa

PF12799.14LRR_4146-184 aa

PF07714.24PK_Tyr_Ser-Thr317-584 aa

PF00069.32Pkinase317-582 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008616	`PF08263.18`	LRRNT_2	29	67	1.6e-11	45.0
LXL04_008616	`PF23598.2`	LRR_14	91	177	6.4e-08	32.4
LXL04_008616	`PF13855.13`	LRR_8	121	178	8.6e-11	42.2
LXL04_008616	`PF12799.14`	LRR_4	146	184	1.4e-07	32.3
LXL04_008616	`PF07714.24`	PK_Tyr_Ser-Thr	317	584	3.2e-47	161.7
LXL04_008616	`PF00069.32`	Pkinase	317	582	4.2e-47	161.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0LGF4`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase FEI 1	50.690%	Swiss-Prot	strong database homology
`C0LGL9`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase FEI 2	50.346%	Swiss-Prot	strong database homology
`Q0WVM4`	Arabidopsis thaliana	Protein CLAVATA3 INSENSITIVE RECEPTOR KINASE 2	35.563%	Swiss-Prot	moderate database homology
`B8BB68`	Oryza sativa subsp. indica	LRR receptor kinase BAK1	36.254%	Swiss-Prot	moderate database homology
`Q6Z4U4`	Oryza sativa subsp. japonica	LRR receptor kinase BAK1	36.254%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card