TkA02G550370 | RubberDandelionOmics

Gene overview

TkA02G550370

Reference: TK1151 Chr: Chr02 Coordinates: 141992537-141997713 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1957 bp · TkA02G550370|TK1151|cDNA

CTTGTTCCCACAATATGACCATATTGTGGGACAATGTACATATGCACACACCACATATATGCACATTTGCATATGTTTTTTTGCGCTTTTTGTATGGAATGTTCAAAATGATTGAAACATATTTATCCATTTTGATGTAAATTCCAAGTTTCCAACTACCATAGTCCACCGTCTAAATTTGACTTAAGCGACTGTACTCTTTTACCCTTGTAACTTCCAAGTTATACACCCTGGAGTCTCTTTCTTTCCCTTTCCGCCGG...

CDS

Download CDS FASTA

1860 bp · TkA02G550370|TK1151|CDS

ATGAACTCTCAGTTAGCTGCAGCTCGATTCAGCTCAACTTTAACTGCCCCAAAGCTATTTATAAGCGGCCTAAACAGAAATACAACCGACGAAAAACTTCAAGAAGCATTTGCCCCGTTTGGCCAGCTTGTTGAAGCAAAAGTGATAATGGATAGAGCGACTCAAAGATCAAAGGGGTTTGCATTTGTGACATATGCATCAATAGAAGAAGCTGAAAAAGCTCGTGCAGAAATGAATGCAAAGTTTTTAGATGGATGGGT...

Protein

Download Protein FASTA

619 aa · TkA02G550370|TK1151|PROTEIN

MNSQLAAARFSSTLTAPKLFISGLNRNTTDEKLQEAFAPFGQLVEAKVIMDRATQRSKGFAFVTYASIEEAEKARAEMNAKFLDGWVIFVDPAKPREYKPLQPEPQQSSEFGFRTNKTIGCYTPWSLFLSLSAGIQTRTLALLLSVSESSNTCKKQCRYVFLPNLFRLSSQNLILERSLVGSFASPKRNFRVFAMTSDVKEASNFISAAPIFLPEGPWKQIPGGVTAAEGFKAAGMYGGLRALGQKPDLALVTCDVDAIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G550370`
TK1151 ID	TkA02G550370
OH-1004 ID	LXL04_012607
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.500
Protein coverage (%)	TK1151 100.000 / OH-1004 97.306 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G550370

Location Chr02:141992537-141997713 (-)

Description Similar to VITISV_037692: Arginine biosynthesis bifunctional protein ArgJ, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37500`	Catalyzes two activities which are involved in the cyclic version of arginine biosynthesis: the synthesis of acetylglutamate from glutamate and acetyl-CoA, and of ornithine by transacetylation between acetylornithine and glutamate.	No verified direct reference in this release
`At5g54580`	Involved in C-to-U editing of mitochondrial RNA.	Two RNA recognition motif-containing proteins are plant mitochondrial editing factors.2015 · DOI: 10.1093/nar/gkv245
`At5g06210`	Probable RNA-binding protein that may be involved in salt and oxidative stress tolerance.	The Arabidopsis chloroplast protein S-RBP11 is involved in oxidative and salt stress responses.2014 · DOI: 10.1007/s00299-013-1560-9
`At3g20930`	Involved in C-to-U editing of chloroplastic RNA.	An RNA recognition motif-containing protein is required for plastid RNA editing in Arabidopsis and maize.2013 · DOI: 10.1073/pnas.1220162110

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0730800`	Involved in C-to-U editing of chloroplastic RNA.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012607 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006526 L-arginine biosynthetic process Biological Process

GO:0006592 ornithine biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004042 L-glutamate N-acetyltransferase activity Molecular Function

GO:0004358 L-glutamate N-acetyltransferase activity, acting on acetyl-L-ornithine as donor Molecular Function

KEGG gene cross-reference

ath:AT2G37500

rcu:8269377

sbi:8081475

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.918

Rank 1 · TkA02G550370 · TK1151

Mitochondrion0.133

Rank 2 · TkA02G550370 · TK1151

Cytoplasm0.059

Rank 3 · TkA02G550370 · TK1151

Peroxisome0.031

Rank 4 · TkA02G550370 · TK1151

Nucleus0.023

Rank 5 · TkA02G550370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16367RRM_717-68 aa

PF00076RRM_119-85 aa

PF28976RRM_ACIN119-79 aa

PF01960ArgJ233-619 aa

PF05188MutS_II298-332 aa

PF00224PK372-454 aa

PF11476TgMIC1429-515 aa

PF14245Pilin_PilA509-539 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G550370	`PF16367`	RRM_7	17	68	0.075	13.7
TkA02G550370	`PF00076`	RRM_1	19	85	5.7e-20	71.7
TkA02G550370	`PF28976`	RRM_ACIN1	19	79	0.0021	18.8
TkA02G550370	`PF01960`	ArgJ	233	619	3.1e-128	428.4
TkA02G550370	`PF05188`	MutS_II	298	332	0.036	15.3
TkA02G550370	`PF00224`	PK	372	454	0.036	13.9
TkA02G550370	`PF11476`	TgMIC1	429	515	0.069	13.6
TkA02G550370	`PF14245`	Pilin_PilA	509	539	0.2	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUR7`	Arabidopsis thaliana	sp\|Q9ZUR7\|ARGJ_ARATH Arginine biosynthesis bifunctional protein ArgJ, chloroplastic	73.000%	Swiss-Prot	High
`Q9FIU6`	Arabidopsis thaliana	sp\|Q9FIU6\|ORRM2_ARATH Organelle RRM domain-containing protein 2, mitochondrial	55.700%	Swiss-Prot	Medium
`Q9FFZ6`	Arabidopsis thaliana	sp\|Q9FFZ6\|RBP11_ARATH Small RNA-binding protein 11, chloroplastic	54.900%	Swiss-Prot	Medium
`Q8L440`	Arabidopsis thaliana	sp\|Q8L440\|ORRM1_ARATH Organelle RRM domain-containing protein 1, chloroplastic	46.600%	Swiss-Prot	Medium
`Q6YWP9`	Oryza sativa subsp. japonica	sp\|Q6YWP9\|ORRM1_ORYSJ Organelle RRM domain-containing protein 1, chloroplastic	46.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card