TkA02G540290 | RubberDandelionOmics

Gene overview

TkA02G540290

Reference: TK1151 Chr: Chr02 Coordinates: 139381732-139384543 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2039 bp · TkA02G540290|TK1151|cDNA

TGAAGCATTTTTTGTTAAAATAAAAGCTGAGAGAAAATCTTAACATCGTTTATCAAATGTTTTTTGAGTTTGAAAGACAGAAACGTTTTATAATTGGGTCCGATTACCGTTTTTGTAAATAGACGAGCAAAAAGAATTCGACTTTCTGCAGATACGTATGATTTCGGAAGATCAGCAGAGAAAAACCAAGAAGAAGATTAGATTTTCAAGCCATTTCCTCCTCCAAGTTCTGTTGTCGTTTTCTTCTGAAATCCTATTTC...

CDS

Download CDS FASTA

1596 bp · TkA02G540290|TK1151|CDS

ATGGTGAAACTGGGTGCGTTTTCAAGGTTCGGATTTGGATTGATTCTCTTATTATCTCTGAATCAAATTCCACCAACAGCTTCGGCTTCAAAATCTAAGGAAGCGTATGTAACTCTTTTATACGGAGATGAATTCGTGTTGGGAGCACGTGTTCTTGGGAAGTCGATTCGGGATACCAGATCCACCAAAGACATGGTCGTTTTGGTCTCCGATGGTGTTTCCGACTACGCCAAAACTCTTCTCCAGGCTGATGGCTGGAT...

Protein

Download Protein FASTA

531 aa · TkA02G540290|TK1151|PROTEIN

MVKLGAFSRFGFGLILLLSLNQIPPTASASKSKEAYVTLLYGDEFVLGARVLGKSIRDTRSTKDMVVLVSDGVSDYAKTLLQADGWIVNPISLLENPNQVRPTRFWGVYTKLKIFNMTDYSKVVYLDADTIVVKNIDVLFKCGKFCANLKHSERLNSGVMVVEPSEKLFKDMVSKVATLHSYTGGDQGFLNAYYSGFPSARVFDPTKTRPVAEMERLSTLYNADVGLYMLANKWMVDEKELCVIHYTLGPLKPWDWWTSW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G540290`
TK1151 ID	TkA02G540290
OH-1004 ID	LXL04_012749
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.100
Protein coverage (%)	TK1151 99.812 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G540290

Location Chr02:139381732-139384543 (-)

Description Similar to IPUT1: Inositol phosphorylceramide glucuronosyltransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g18480`	Mediates the transfer of glucuronic acid (GlcA) from UDP-GlcA to glycosyl inositol phosphorylceramides (GIPCs).	Identification of a sphingolipid α-glucuronosyltransferase that is essential for pollen function in Arabidopsis.2014 · DOI: 10.1105/tpc.114.129171 Glycosylation of inositol phosphorylceramide sphingolipids is required for normal growth and reproduction in Arabidopsis.2017 · DOI: 10.1111/tpj.13382
`At1g77130`	May be involved in the substitutions of the xylan backbone in stem glucuronoxylan.	No verified direct reference in this release
`At1g08990`	May be involved in the substitutions of the xylan backbone in stem glucuronoxylan.	No verified direct reference in this release
`At3g18660`	Glycosyltransferase required for the addition of both glucuronic acid and 4-O-methylglucuronic acid branches to xylan in stem cell walls.	Absence of branches from xylan in Arabidopsis gux mutants reveals potential for simplification of lignocellulosic biomass.2010 · DOI: 10.1073/pnas.1005456107 An integrative approach to the identification of Arabidopsis and rice genes involved in xylan and secondary wall development.2010 · DOI: 10.1371/journal.pone.0015481
`At1g54940`	May be involved in the substitutions of the xylan backbone in stem glucuronoxylan.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012749 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006673 inositol phosphoceramide metabolic process Biological Process

GO:0009555 pollen development Biological Process

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010417 glucuronoxylan biosynthetic process Biological Process

GO:0045492 xylan biosynthetic process Biological Process

GO:0046513 ceramide biosynthetic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0000139 Golgi membrane Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G08990

ath:AT1G77130

ath:AT2G35710

ath:AT3G18660

ath:AT5G18480

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.576

Rank 1 · TkA02G540290 · TK1151

Endoplasmic reticulum0.171

Rank 2 · TkA02G540290 · TK1151

Lysosome / Vacuole0.121

Rank 3 · TkA02G540290 · TK1151

Cytoplasm0.099

Rank 4 · TkA02G540290 · TK1151

Cell membrane0.077

Rank 5 · TkA02G540290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01501Glyco_transf_838-141 aa

PF11051Mannosyl_trans3118-145 aa

PF01501Glyco_transf_8155-257 aa

PF21976SMIM43296-308 aa

PF11992TgpA_N296-419 aa

PF21976SMIM43397-443 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G540290	`PF01501`	Glyco_transf_8	38	141	2.6e-11	44.3
TkA02G540290	`PF11051`	Mannosyl_trans3	118	145	0.045	13.9
TkA02G540290	`PF01501`	Glyco_transf_8	155	257	2.6e-11	44.3
TkA02G540290	`PF21976`	SMIM43	296	308	0.13	13.0
TkA02G540290	`PF11992`	TgpA_N	296	419	2.0	8.0
TkA02G540290	`PF21976`	SMIM43	397	443	0.13	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GWB7`	Arabidopsis thaliana	sp\|Q8GWB7\|GUX6_ARATH Inositol phosphorylceramide glucuronosyltransferase 1	64.600%	Swiss-Prot	High
`Q8W4A7`	Arabidopsis thaliana	sp\|Q8W4A7\|GUX3_ARATH Putative UDP-glucuronate:xylan alpha-glucuronosyltransferase 3	33.000%	Swiss-Prot	Medium
`F4HZC3`	Arabidopsis thaliana	sp\|F4HZC3\|GUX5_ARATH Putative UDP-glucuronate:xylan alpha-glucuronosyltransferase 5	42.400%	Swiss-Prot	Low
`Q9LSB1`	Arabidopsis thaliana	sp\|Q9LSB1\|GUX1_ARATH UDP-glucuronate:xylan alpha-glucuronosyltransferase 1	36.600%	Swiss-Prot	Low
`Q9FZ37`	Arabidopsis thaliana	sp\|Q9FZ37\|GUX4_ARATH Putative UDP-glucuronate:xylan alpha-glucuronosyltransferase 4	38.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card