TkA02G535840 | RubberDandelionOmics

Gene overview

TkA02G535840

Reference: TK1151 Chr: Chr02 Coordinates: 138181986-138185870 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3564 bp · TkA02G535840|TK1151|cDNA

CACGATTCTTCAATCATACCATCTATGTCGTCTTCTTCAACTTCATCCATTCACAAAAGCTTCACATATGATGTATTTTTGAGTTTTGGAGGCAAAGACACCCGTACGAACTTCGTTGACCATCTTTATCATGCTCTTCTGGACAGAAACATTCGCACTTACAAGGACGACGAGGAAATCAATAAAGGGAAAAGAATCAGTGATGACCTCATGAAAGCCATTGAAGACTCAAAATACTTCATCATTGTTTTCTCCAAAAA...

CDS

Download CDS FASTA

3540 bp · TkA02G535840|TK1151|CDS

ATGTCGTCTTCTTCAACTTCATCCATTCACAAAAGCTTCACATATGATGTATTTTTGAGTTTTGGAGGCAAAGACACCCGTACGAACTTCGTTGACCATCTTTATCATGCTCTTCTGGACAGAAACATTCGCACTTACAAGGACGACGAGGAAATCAATAAAGGGAAAAGAATCAGTGATGACCTCATGAAAGCCATTGAAGACTCAAAATACTTCATCATTGTTTTCTCCAAAAATTATGCCTCTTCACCTTGGTGCTT...

Protein

Download Protein FASTA

1180 aa · TkA02G535840|TK1151|PROTEIN

MSSSSTSSIHKSFTYDVFLSFGGKDTRTNFVDHLYHALLDRNIRTYKDDEEINKGKRISDDLMKAIEDSKYFIIVFSKNYASSPWCLEELVRIMDCHKTTKHNAYPVFYDVEPWEVRYQSGAVGETFAGHEKEESAGKWTVALKEAADLAGWELKNTAGGHEAKCIRQIVEKLSLELRSINVHVDKNLVGMETRVNDIVSSLESASDDVRMIGIKGIGGGGKTTLARAVFDKIFFRFEGKSFIDKVREVSNDSSSGLKLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G535840`
TK1151 ID	TkA02G535840
OH-1004 ID	LXL04_012832
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	84.700
Protein coverage (%)	TK1151 98.390 / OH-1004 69.688 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G535840

Location Chr02:138181986-138185870 (+)

Description Similar to At2g25100: Ribonuclease H2 subunit A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64070`	TIR-NB-LRR receptor-like protein that confers resistance to the pathogen Leptosphaeria maculans (blackleg disease).	Transgressive segregation reveals two Arabidopsis TIR-NB-LRR resistance genes effective against Leptosphaeria maculans, causal agent of blackleg disease.2006 · DOI: 10.1111/j.1365-313x.2006.02688.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012832 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006298 mismatch repair Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0019677 NAD+ catabolic process Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0043137 DNA replication, removal of RNA primer Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0032299 ribonuclease H2 complex Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G25100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.432

Rank 1 · TkA02G535840 · TK1151

Cell membrane0.273

Rank 2 · TkA02G535840 · TK1151

Nucleus0.269

Rank 3 · TkA02G535840 · TK1151

Endoplasmic reticulum0.087

Rank 4 · TkA02G535840 · TK1151

Extracellular0.050

Rank 5 · TkA02G535840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26659PH_DUOX14-43 aa

PF01582TIR15-180 aa

PF13676TIR_217-112 aa

PF00931NB-ARC28-74 aa

PF00004AAA31-77 aa

PF12078DUF3557164-185 aa

PF23282WHD_ROQ1179-191 aa

PF00931NB-ARC192-364 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G535840	`PF26659`	PH_DUOX	14	43	0.012	16.0
TkA02G535840	`PF01582`	TIR	15	180	1.9e-43	149.0
TkA02G535840	`PF13676`	TIR_2	17	112	1.2e-16	62.0
TkA02G535840	`PF00931`	NB-ARC	28	74	6.3e-21	75.4
TkA02G535840	`PF00004`	AAA	31	77	0.14	13.3
TkA02G535840	`PF12078`	DUF3557	164	185	0.51	11.0
TkA02G535840	`PF23282`	WHD_ROQ1	179	191	3.8e-12	46.9
TkA02G535840	`PF00931`	NB-ARC	192	364	6.3e-21	75.4
TkA02G535840	`PF25199`	nSTAND_NTPase5	195	228	0.067	13.7
TkA02G535840	`PF13401`	AAA_22	212	311	0.042	14.9
TkA02G535840	`PF00004`	AAA	216	274	0.14	13.3
TkA02G535840	`PF25199`	nSTAND_NTPase5	270	314	0.067	13.7
TkA02G535840	`PF23282`	WHD_ROQ1	434	501	3.8e-12	46.9
TkA02G535840	`PF23622`	LRR_At1g61320_AtMIF1	445	472	1.4e-09	38.5
TkA02G535840	`PF07725`	LRR_3	623	640	0.14	12.7
TkA02G535840	`PF23622`	LRR_At1g61320_AtMIF1	645	719	1.4e-09	38.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I594`	Arabidopsis thaliana	sp\|F4I594\|RLM1A_ARATH Disease resistance protein RML1A	35.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card