TkA02G519400 | RubberDandelionOmics

Gene overview

TkA02G519400

Reference: TK1151 Chr: Chr02 Coordinates: 133863095-133867263 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2547 bp · TkA02G519400|TK1151|cDNA

GAGAAGTAGAAGATAGTCTGAACTCCAAAAGCTCCACCACCACCAACATCATTCCTCCTCCTCCCTCCCTCCCTCCCTCTGCAACTCCTTGAACTGCGTGCTCGGAAATCAGACACTAGCTGACCGTTGCATCTCTCTCTCTCTCTCTCTCTCTCTCTCTAGGAGAACAGGCGAGCATCATTAACGGCGATCACTGTAGCTCTCAACCATTACAACAGTTTCAAGCTTTGTTGTTTCACTGTGAAGTATGTCTGTAGCTT...

CDS

Download CDS FASTA

1794 bp · TkA02G519400|TK1151|CDS

ATGAAGCTCCACGTGGAAGTTTCTTTGGTTTTCTTCATTAGCTTGATCTTGATTCAACACACCATTTGCACAGATGAAGTTCCAGACATAAACAAGTGGACATGTACATGCTATGCAAACCAACTATACCATCATGTCATCCTTCCACCCCAATGCTCTTCTTCATGTAACTGCACCTCAGAAAGTACAAGTCAAAGTAGATGGAAATGCATATGTCCAAGCGATAAACTACCTGAAGTGGCTACAAGTAATGATACTAA...

Protein

Download Protein FASTA

597 aa · TkA02G519400|TK1151|PROTEIN

MKLHVEVSLVFFISLILIQHTICTDEVPDINKWTCTCYANQLYHHVILPPQCSSSCNCTSESTSQSRWKCICPSDKLPEVATSNDTNCFMSCNCNSGTLIKSESLKKQFSSKSVLIILLLCMVVTTLAIFASIMFYIYRKHTNPKQPPLSSSSDKDTSYNSTTNLISYKASSLQDSKIYIHSPKNPFTGFIYKASFLFRKQPRTVQGTITSFSYYELETATNKFSENNLIGVGVSSHVYYGQLKDGKLVAVKRLKSHGGP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G519400`
TK1151 ID	TkA02G519400
OH-1004 ID	LXL04_013062
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G519400

Location Chr02:133863095-133867263 (+)

Description Similar to NCRK: Receptor-like serine/threonine-protein kinase NCRK

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28250`	Receptor-like serine/threonine-protein kinase NCRK.	No verified direct reference in this release
`At1g70460`	Negatively regulates root hair elongation.	No verified direct reference in this release
`At1g26150`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At5g38560`	Could be involved in the negative regulation of root growth.	PERK-KIPK-KCBP signalling negatively regulates root growth in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/eru390
`At1g68690`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013062 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007165 signal transduction Biological Process

GO:0010089 xylem development Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005768 endosome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0012505 endomembrane system Cellular Component

GO:0004672 protein kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G26150

ath:AT1G68690

ath:AT1G70460

ath:AT2G28250

ath:AT5G38560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.777

Rank 1 · TkA02G519400 · TK1151

Cytoplasm0.125

Rank 2 · TkA02G519400 · TK1151

Nucleus0.117

Rank 3 · TkA02G519400 · TK1151

Endoplasmic reticulum0.083

Rank 4 · TkA02G519400 · TK1151

Lysosome / Vacuole0.033

Rank 5 · TkA02G519400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02430AMA-151-145 aa

PF06084Cytomega_TRL1055-140 aa

PF00069Pkinase225-502 aa

PF07714PK_Tyr_Ser-Thr228-504 aa

PF01636APH230-312 aa

PF03109ABC1236-255 aa

PF17667Pkinase_fungal255-303 aa

PF17667Pkinase_fungal333-380 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G519400	`PF02430`	AMA-1	51	145	0.0029	17.1
TkA02G519400	`PF06084`	Cytomega_TRL10	55	140	3.0	8.6
TkA02G519400	`PF00069`	Pkinase	225	502	9.8e-41	140.6
TkA02G519400	`PF07714`	PK_Tyr_Ser-Thr	228	504	3.3e-38	132.2
TkA02G519400	`PF01636`	APH	230	312	0.0029	18.1
TkA02G519400	`PF03109`	ABC1	236	255	0.0081	16.1
TkA02G519400	`PF17667`	Pkinase_fungal	255	303	0.043	13.3
TkA02G519400	`PF17667`	Pkinase_fungal	333	380	0.043	13.3
TkA02G519400	`PF01636`	APH	339	366	0.0029	18.1
TkA02G519400	`PF03109`	ABC1	340	378	0.0081	16.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYY5`	Arabidopsis thaliana	sp\|Q8VYY5\|NCRK_ARATH Receptor-like serine/threonine-protein kinase NCRK	53.500%	Swiss-Prot	High
`Q9CAL8`	Arabidopsis thaliana	sp\|Q9CAL8\|PEK13_ARATH Proline-rich receptor-like protein kinase PERK13	46.500%	Swiss-Prot	Low
`Q9C660`	Arabidopsis thaliana	sp\|Q9C660\|PEK10_ARATH Proline-rich receptor-like protein kinase PERK10	44.700%	Swiss-Prot	Medium
`Q9FFW5`	Arabidopsis thaliana	sp\|Q9FFW5\|PERK8_ARATH Proline-rich receptor-like protein kinase PERK8	46.000%	Swiss-Prot	Low
`Q9SX31`	Arabidopsis thaliana	sp\|Q9SX31\|PERK9_ARATH Proline-rich receptor-like protein kinase PERK9	45.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card