LXL04_013062 | RubberDandelionOmics

Gene overview

LXL04_013062

Reference: OH-1004 Chr: Chr03 Coordinates: 23382141-23384483 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1794 bp · LXL04_013062|LXL04_013062|OH1004|cDNA

ATGAAGCTCCACTTGGAAGTTTCTTTGGTTTTCTTCATTAGCTTGATCTTGATTCAGCACATCATTTGCGCAGATGAAGTTCCAGACATAAACAAGTGGACATGTACATGCTATGCAAACCAACTATACCATCATGTCATCCTTCCACCCCGATGCTCTTCTTCCTGTAACTGCACTTCAGAAAGTACAAGTCAAAGTAGATGGAAATGCATATGTCCAAGCGATAAACTCCCTGAAGTGGCTACAAGTAACGATACTAA...

CDS

Download CDS FASTA

1794 bp · LXL04_013062|LXL04_013062|OH1004|CDS

ATGAAGCTCCACTTGGAAGTTTCTTTGGTTTTCTTCATTAGCTTGATCTTGATTCAGCACATCATTTGCGCAGATGAAGTTCCAGACATAAACAAGTGGACATGTACATGCTATGCAAACCAACTATACCATCATGTCATCCTTCCACCCCGATGCTCTTCTTCCTGTAACTGCACTTCAGAAAGTACAAGTCAAAGTAGATGGAAATGCATATGTCCAAGCGATAAACTCCCTGAAGTGGCTACAAGTAACGATACTAA...

Protein

Download Protein FASTA

597 aa · LXL04_013062|LXL04_013062|OH1004|PROTEIN

MKLHLEVSLVFFISLILIQHIICADEVPDINKWTCTCYANQLYHHVILPPRCSSSCNCTSESTSQSRWKCICPSDKLPEVATSNDTNCFMSCNCNSGTLIKSESLKKQFSSKSVLIILLLCMVVTTLAIFASIMFYIYRKHTNPKQPPLSSSSDKDTSYNSTTNLISYKASSLLDSKIYIHSPKNPFTGFIYKASFLFRKQPRTVQGTITSFSYYELETATNKFSENNLIGVGVSSHVYYGQLKDGKLVAVKRLKSHGGP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013062`
TK1151 ID	TkA02G519400
OH-1004 ID	LXL04_013062
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013062

Location Chr03:23382141-23384483 (-)

Description Similar to NCRK: Receptor-like serine/threonine-protein kinase NCRK

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28250`	Receptor-like serine/threonine-protein kinase NCRK.	No verified direct reference in this release
`At5g38560`	Could be involved in the negative regulation of root growth.	PERK-KIPK-KCBP signalling negatively regulates root growth in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/eru390
`At1g70460`	Negatively regulates root hair elongation.	No verified direct reference in this release
`At1g68690`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At1g26150`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013062 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007165 signal transduction Biological Process

GO:0010089 xylem development Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005768 endosome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0012505 endomembrane system Cellular Component

GO:0004672 protein kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G26150

ath:AT1G68690

ath:AT1G70460

ath:AT2G28250

ath:AT5G38560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.776

Rank 1 · LXL04_013062 · OH-1004

Cytoplasm0.124

Rank 2 · LXL04_013062 · OH-1004

Nucleus0.118

Rank 3 · LXL04_013062 · OH-1004

Endoplasmic reticulum0.084

Rank 4 · LXL04_013062 · OH-1004

Lysosome / Vacuole0.033

Rank 5 · LXL04_013062 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase225-502 aa

PF07714.24PK_Tyr_Ser-Thr228-504 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013062	`PF00069.32`	Pkinase	225	502	6.4e-41	141.2
LXL04_013062	`PF07714.24`	PK_Tyr_Ser-Thr	228	504	1.2e-38	133.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYY5`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase NCRK	53.512%	Swiss-Prot	strong database homology
`Q9FFW5`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK8	37.176%	Swiss-Prot	moderate database homology
`Q9CAL8`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK13	46.465%	Swiss-Prot	weak database homology
`Q9SX31`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK9	44.272%	Swiss-Prot	moderate database homology
`Q9C660`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK10	43.260%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card