TkA02G480560 | RubberDandelionOmics

Gene overview

TkA02G480560

Reference: TK1151 Chr: Chr02 Coordinates: 122608513-122611101 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

585 bp · TkA02G480560|TK1151|cDNA

ATGTCCTTGTCTGATCTTCTTCCTGGACGTAAAAAGATGGATAAGGCTACTGTTTTGGAAGATGCGAGTAACTACATAATCCAACTTCAAACCCGGGTGAAGGAACTCGAAGAAAGATCAGTGAAGGGAAAAGATATCATGCGTGAGTCGGTTGTTTCCTTTAGAAGGTCGATGTTTTGTGTAAATCCTGGAGATCAGGCATCTTGTTCAGATGAAACTTACAAAGACTTACCTAGTAGCTCCACATATGATCCTGAGAT...

CDS

Download CDS FASTA

585 bp · TkA02G480560|TK1151|CDS

ATGTCCTTGTCTGATCTTCTTCCTGGACGTAAAAAGATGGATAAGGCTACTGTTTTGGAAGATGCGAGTAACTACATAATCCAACTTCAAACCCGGGTGAAGGAACTCGAAGAAAGATCAGTGAAGGGAAAAGATATCATGCGTGAGTCGGTTGTTTCCTTTAGAAGGTCGATGTTTTGTGTAAATCCTGGAGATCAGGCATCTTGTTCAGATGAAACTTACAAAGACTTACCTAGTAGCTCCACATATGATCCTGAGAT...

Protein

Download Protein FASTA

194 aa · TkA02G480560|TK1151|PROTEIN

MSLSDLLPGRKKMDKATVLEDASNYIIQLQTRVKELEERSVKGKDIMRESVVSFRRSMFCVNPGDQASCSDETYKDLPSSSTYDPEIKARISGRNILLRIYCGEHSSIMMKTLIEMERLHITHICCSVLPLSNTAHVITITAKMNEEMVITTKYLGKCLQSALSNFPLHVLILKIYGTAFSLVLFSSYHIIILS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G480560`
TK1151 ID	TkA02G480560
OH-1004 ID	LXL04_013660
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.400
Protein coverage (%)	TK1151 93.814 / OH-1004 38.889 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G480560

Location Chr02:122608513-122611101 (-)

Description Similar to TPC1: Two pore calcium channel protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g22770`	Transcription activator that regulates the expression of at least NAI2, PYK10 and PBP1.	A novel ER-derived compartment, the ER body, selectively accumulates a beta-glucosidase with an ER-retention signal in Arabidopsis.2003 · DOI: 10.1046/j.1365-313x.2003.01636.x NAI1 gene encodes a basic-helix-loop-helix-type putative transcription factor that regulates the formation of an endoplasmic reticulum-derived structure, the ER body.2004 · DOI: 10.1105/tpc.021154 Activation of an ER-body-localized beta-glucosidase via a cytosolic binding partner in damaged tissues of Arabidopsis thaliana.2005 · DOI: 10.1093/pcp/pci126 PYK10, a beta-glucosidase located in the endoplasmatic reticulum, is crucial for the beneficial interaction between Arabidopsis thaliana and the endophytic fungus Piriformospora indica.2008 · DOI: 10.1111/j.1365-313x.2008.03424.x Antagonistic jacalin-related lectins regulate the size of ER body-type beta-glucosidase complexes in Arabidopsis thaliana.2008 · DOI: 10.1093/pcp/pcn075 NAI2 is an endoplasmic reticulum body component that enables ER body formation in Arabidopsis thaliana.2008 · DOI: 10.1105/tpc.108.059345
`At4g37850`	Transcription factor bHLH25.	No verified direct reference in this release
`At2g22760`	Transcription factor bHLH19.	No verified direct reference in this release
`At2g22750`	Transcription factor bHLH18.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013660 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006816 calcium ion transport Biological Process

GO:0006952 defense response Biological Process

GO:0009845 seed germination Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0080141 regulation of jasmonic acid biosynthetic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT4G03560

dosa:Os01g0678500

nta:107770546

nta:107819477

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.781

Rank 1 · TkA02G480560 · TK1151

Cytoplasm0.288

Rank 2 · TkA02G480560 · TK1151

Cell membrane0.059

Rank 3 · TkA02G480560 · TK1151

Endoplasmic reticulum0.032

Rank 4 · TkA02G480560 · TK1151

Lysosome / Vacuole0.019

Rank 5 · TkA02G480560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010HLH2-30 aa

PF23177bHLH_IRO36-41 aa

PF03233Cauli_AT11-59 aa

PF08613Cyclin71-142 aa

PF03233Cauli_AT132-155 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G480560	`PF00010`	HLH	2	30	0.00027	21.4
TkA02G480560	`PF23177`	bHLH_IRO3	6	41	0.00086	20.3
TkA02G480560	`PF03233`	Cauli_AT	11	59	0.074	13.7
TkA02G480560	`PF08613`	Cyclin	71	142	0.046	14.9
TkA02G480560	`PF03233`	Cauli_AT	132	155	0.074	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S3F1`	Arabidopsis thaliana	sp\|Q8S3F1\|BH020_ARATH Transcription factor NAI1	37.000%	Swiss-Prot	Medium
`Q9T072`	Arabidopsis thaliana	sp\|Q9T072\|BH025_ARATH Transcription factor bHLH25	39.600%	Swiss-Prot	Medium
`Q1PF16`	Arabidopsis thaliana	sp\|Q1PF16\|BH019_ARATH Transcription factor bHLH19	31.300%	Swiss-Prot	Medium
`Q1PF17`	Arabidopsis thaliana	sp\|Q1PF17\|BH018_ARATH Transcription factor bHLH18	32.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card