TkA02G406860 | RubberDandelionOmics

Gene overview

TkA02G406860

Reference: TK1151 Chr: Chr02 Coordinates: 103456394-103459971 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2015 bp · TkA02G406860|TK1151|cDNA

CTCAAGTACTGTCAATTGAGAATAAAGTGTTGGGATTTTTATGGCCGATACCATTAGTCATCCCCATAATTATCAGCTCACCCTCTCCTCTTTCCTGCATTCATTTTCACCCAAAATCCCAATTCACAAAATTTCATACCCTAATCCACAGACGCTCGATACAGAGTGAAGATATACCTCTCTACCAAATATACTTTTTGCCTATTAGATAGCCTATTAGATACAAAAATAACTATGAATCATCAATCTATGAACATCCG...

CDS

Download CDS FASTA

1578 bp · TkA02G406860|TK1151|CDS

ATGAATCATCAATCTATGAACATCCGAATTCAGGCACCATGCCCGCCTTCTCCTTCTTCTGCATTTCCTCCGAGGTTCCATCACAAAACTCCTACAATATTGCCACGTGCAATTTGCTCTTCTGATGTGGCATCCCATGTTGTGGCGCAAATGGAGTCCTCTTCTGACACCATTACAACTTGGAAACATAAACGCACATTTGGGTGTTTACAAAAACAATCCTTATTAAAGCAGCCTTTAAACAAAGATTTAAAGCCATT...

Protein

Download Protein FASTA

525 aa · TkA02G406860|TK1151|PROTEIN

MNHQSMNIRIQAPCPPSPSSAFPPRFHHKTPTILPRAICSSDVASHVVAQMESSSDTITTWKHKRTFGCLQKQSLLKQPLNKDLKPLKALLTSTTQDTSSSLANGGKIGVLLLNLGGPETLDDVQPFLFNLFADPDIIRLPRLFRFLQKPLAQFISVARAPKSKEGYAAIGGGSPLRQITDAQANELRKALYEKNVPAEVYVGMRYWHPFTEEAIEQIKKDGVNKLVVLPLYPQFSISTSGSSLRLLESIFREDEYLVNM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G406860`
TK1151 ID	TkA02G406860
OH-1004 ID	LXL04_014642
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.900
Protein coverage (%)	TK1151 99.429 / OH-1004 89.735 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G406860

Location Chr02:103456394-103459971 (-)

Description Similar to HEMH: Ferrochelatase-2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30390`	Catalyzes the last step of heme biosynthesis by inserting ferrous iron into protoporphyrin IX to produce protoheme.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0361200`	Catalyzes the ferrous insertion into protoporphyrin IX.	No verified direct reference in this release
`UniProt: A2Y3Q5`	Catalyzes the ferrous insertion into protoporphyrin IX.	No verified direct reference in this release
`Os09g0297000`	Catalyzes the ferrous insertion into protoporphyrin IX.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014642 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006779 porphyrin-containing compound biosynthetic process Biological Process

GO:0006783 heme biosynthetic process Biological Process

GO:0033014 tetrapyrrole biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0055035 plastid thylakoid membrane Cellular Component

GO:0004325 ferrochelatase activity Molecular Function

KEGG gene cross-reference

ath:AT2G30390

dosa:Os05g0361200

dosa:Os09g0297000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.980

Rank 1 · TkA02G406860 · TK1151

Mitochondrion0.036

Rank 2 · TkA02G406860 · TK1151

Cytoplasm0.021

Rank 3 · TkA02G406860 · TK1151

Nucleus0.015

Rank 4 · TkA02G406860 · TK1151

Peroxisome0.014

Rank 5 · TkA02G406860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00762Ferrochelatase107-431 aa

PF01903CbiX180-231 aa

PF01903CbiX347-383 aa

PF31213HliA478-511 aa

PF00504Chloroa_b-bind480-503 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G406860	`PF00762`	Ferrochelatase	107	431	1.1e-112	376.8
TkA02G406860	`PF01903`	CbiX	180	231	0.011	16.6
TkA02G406860	`PF01903`	CbiX	347	383	0.011	16.6
TkA02G406860	`PF31213`	HliA	478	511	2.6e-07	31.2
TkA02G406860	`PF00504`	Chloroa_b-bind	480	503	0.015	16.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04921`	Arabidopsis thaliana	sp\|O04921\|HEMH2_ARATH Ferrochelatase-2, chloroplastic	85.800%	Swiss-Prot	High
`Q0DIV0`	Oryza sativa subsp. japonica	sp\|Q0DIV0\|HEMH2_ORYSJ Ferrochelatase-2, chloroplastic	83.000%	Swiss-Prot	High
`A2Y3Q5`	Oryza sativa subsp. indica	sp\|A2Y3Q5\|HEMH_ORYSI Ferrochelatase-2, chloroplastic	83.000%	Swiss-Prot	High
`Q69TB1`	Oryza sativa subsp. japonica	sp\|Q69TB1\|HEMH1_ORYSJ Ferrochelatase-1, chloroplastic	68.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card