TkA02G173970 | RubberDandelionOmics

Gene overview

TkA02G173970

Reference: TK1151 Chr: Chr02 Coordinates: 44718255-44720466 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1213 bp · TkA02G173970|TK1151|cDNA

TTTTTCTTGTGTAATATTTGGCATGGAAATAGATATTTGCCCGCCCTTTCTATTTTTCTTTTCTTCTTTCTTTCTTCCCAAGCACAAGAACCCTAATTAAAAGCTTTCATTATTCACAATTTTTTCTCATATCAAAAGCCATATCCTCCACTAGTTGGTCTCGATTTGAAATATGGTAGTCGGCAGAATTACATCCCGGATTGCAAGGAACGTCGTTACTCGGTATCAAAGCTCTTCGATCCTCCACGGCCGACCTGATA...

CDS

Download CDS FASTA

834 bp · TkA02G173970|TK1151|CDS

ATGGTAGTCGGCAGAATTACATCCCGGATTGCAAGGAACGTCGTTACTCGGTATCAAAGCTCTTCGATCCTCCACGGCCGACCTGATAGTCATCGCACGATTCCAATAATCGGAAATCGTTTTCCTGGTTCACAGAACAAGGTAATAAACAATTCTTTTCTCACTTCATCTGCCTTCCAAAGATTCAGCCTCTCATCATCTGCATCTCCACAACCCAACGAAAAGGGAGCTTCCGAAAACGGAAAAGAAACCACAACCGA...

Protein

Download Protein FASTA

277 aa · TkA02G173970|TK1151|PROTEIN

MVVGRITSRIARNVVTRYQSSSILHGRPDSHRTIPIIGNRFPGSQNKVINNSFLTSSAFQRFSLSSSASPQPNEKGASENGKETTTDENSPPKEASDDLTMEDMIGLVTEKEELLKTKQEQIKNLEDKLLRSYADMENVMARTKREAENSKKFAIQNFAKSLLDVADNLDRASSVVKESFSKIDTSGDTAGAVPLLKTLLEGVEMTEKQLAEVFKKFGVEKYDPTNEEFDPNRHNAVFQVPDPSKSPDTVAVVLKAGYML...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G173970`
TK1151 ID	TkA02G173970
OH-1004 ID	LXL04_016221
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G173970

Location Chr02:44718255-44720466 (-)

Description Similar to Mge1: GrpE protein homolog 1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g26780`	Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner (By similarity).	Recent gene duplication and subfunctionalization produced a mitochondrial GrpE, the nucleotide exchange factor of the Hsp70 complex, specialized in thermotolerance to chronic heat stress in Arabidopsis.2012 · DOI: 10.1104/pp.111.187674
`At5g55200`	Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016221 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0009408 response to heat Biological Process

GO:0009411 response to UV Biological Process

GO:0010286 heat acclimation Biological Process

GO:0030150 protein import into mitochondrial matrix Biological Process

GO:0001405 PAM complex, Tim23 associated import motor Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000774 adenyl-nucleotide exchange factor activity Molecular Function

GO:0005507 copper ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G26780

ath:AT5G55200

bra:BRADO0171

nwi:Nwi_0195

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.920

Rank 1 · TkA02G173970 · TK1151

Cytoplasm0.080

Rank 2 · TkA02G173970 · TK1151

Plastid0.050

Rank 3 · TkA02G173970 · TK1151

Nucleus0.050

Rank 4 · TkA02G173970 · TK1151

Cell membrane0.021

Rank 5 · TkA02G173970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30465Akirin59-131 aa

PF03618Kinase-PPPase89-147 aa

PF01025GrpE109-273 aa

PF15005IZUMO119-224 aa

PF10437Lip_prot_lig_C119-130 aa

PF00076RRM_1128-160 aa

PF13499EF-hand_7162-188 aa

PF10437Lip_prot_lig_C175-224 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G173970	`PF30465`	Akirin	59	131	0.086	14.1
TkA02G173970	`PF03618`	Kinase-PPPase	89	147	0.031	14.6
TkA02G173970	`PF01025`	GrpE	109	273	3.9e-50	170.5
TkA02G173970	`PF15005`	IZUMO	119	224	0.0002	22.7
TkA02G173970	`PF10437`	Lip_prot_lig_C	119	130	0.11	13.2
TkA02G173970	`PF00076`	RRM_1	128	160	0.19	12.3
TkA02G173970	`PF13499`	EF-hand_7	162	188	0.36	11.9
TkA02G173970	`PF10437`	Lip_prot_lig_C	175	224	0.11	13.2
TkA02G173970	`PF13499`	EF-hand_7	177	219	0.36	11.9
TkA02G173970	`PF18606`	HTH_53	195	222	0.16	12.4
TkA02G173970	`PF00076`	RRM_1	204	220	0.19	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LB47`	Arabidopsis thaliana	sp\|Q8LB47\|MGE2_ARATH GrpE protein homolog 2, mitochondrial	54.300%	Swiss-Prot	High
`Q9FLP3`	Arabidopsis thaliana	sp\|Q9FLP3\|MGE1_ARATH GrpE protein homolog 1, mitochondrial	53.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card