LXL04_016221 | RubberDandelionOmics

Gene overview

LXL04_016221

Reference: OH-1004 Chr: Chr03 Coordinates: 115542376-115544250 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

834 bp · LXL04_016221|LXL04_016221|OH1004|cDNA

ATGGTAGTCGGCAGAATTACATCCCGGATTGCAAGGACCGTCGTTACTCGGTACCAAAGTTCTTCCATCCTCCACGGGCGACCTGATAGTCATCGCACGATTCCAATAATCGGAAATCGTTTTCCTGGTTCACAGAACAAGGTGATACACAATTCTTTTCTCACTTCATCTACCTTCCAAAAATTCAGCCTCTCATCATCTGCATCTCCACAACCCAACGAAAAGGGAACTTCCGAAAACGGAAAAGAAACCACAACCGA...

CDS

Download CDS FASTA

834 bp · LXL04_016221|LXL04_016221|OH1004|CDS

ATGGTAGTCGGCAGAATTACATCCCGGATTGCAAGGACCGTCGTTACTCGGTACCAAAGTTCTTCCATCCTCCACGGGCGACCTGATAGTCATCGCACGATTCCAATAATCGGAAATCGTTTTCCTGGTTCACAGAACAAGGTGATACACAATTCTTTTCTCACTTCATCTACCTTCCAAAAATTCAGCCTCTCATCATCTGCATCTCCACAACCCAACGAAAAGGGAACTTCCGAAAACGGAAAAGAAACCACAACCGA...

Protein

Download Protein FASTA

277 aa · LXL04_016221|LXL04_016221|OH1004|PROTEIN

MVVGRITSRIARTVVTRYQSSSILHGRPDSHRTIPIIGNRFPGSQNKVIHNSFLTSSTFQKFSLSSSASPQPNEKGTSENGKETTTDENSPPKEASDDLTMEDMIGLVTEKEELLKTKQEQIKNLEDKLLRSYADMENVMARTKREAENSKKFAIQNFAKSLLDVADNLDRASSVVKESFSKIDTSGDTAGAVPLLKTLLEGVEMTEKQLAEVFKKFGVEKYDPTNEEFDPNRHNAVFQVPDPSKSPDTVAVVLKAGYML...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016221`
TK1151 ID	TkA02G173970
OH-1004 ID	LXL04_016221
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016221

Location Chr03:115542376-115544250 (+)

Description Similar to Mge1: GrpE protein homolog 1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55200`	Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner (By similarity).	No verified direct reference in this release
`At4g26780`	Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner (By similarity).	Recent gene duplication and subfunctionalization produced a mitochondrial GrpE, the nucleotide exchange factor of the Hsp70 complex, specialized in thermotolerance to chronic heat stress in Arabidopsis.2012 · DOI: 10.1104/pp.111.187674

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016221 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0009408 response to heat Biological Process

GO:0009411 response to UV Biological Process

GO:0010286 heat acclimation Biological Process

GO:0030150 protein import into mitochondrial matrix Biological Process

GO:0001405 PAM complex, Tim23 associated import motor Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000774 adenyl-nucleotide exchange factor activity Molecular Function

GO:0005507 copper ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G26780

ath:AT5G55200

bra:BRADO0171

nwi:Nwi_0195

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.919

Rank 1 · LXL04_016221 · OH-1004

Cytoplasm0.078

Rank 2 · LXL04_016221 · OH-1004

Plastid0.053

Rank 3 · LXL04_016221 · OH-1004

Nucleus0.049

Rank 4 · LXL04_016221 · OH-1004

Cell membrane0.021

Rank 5 · LXL04_016221 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01025.25GrpE109-273 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016221	`PF01025.25`	GrpE	109	273	3.9e-50	170.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLP3`	Arabidopsis thaliana	GrpE protein homolog 1, mitochondrial	54.054%	Swiss-Prot	strong database homology
`Q8LB47`	Arabidopsis thaliana	GrpE protein homolog 2, mitochondrial	53.797%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card