TkA02G102480 | RubberDandelionOmics

Gene overview

TkA02G102480

Reference: TK1151 Chr: Chr02 Coordinates: 26798516-26802757 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1644 bp · TkA02G102480|TK1151|cDNA

CTGACAATTAATTAATAATCGATGGGGGTTGAGAGTAAATGAGGGAAAGGAAGAAGAAGCAACACAAAGGGGAAAATGGGGTTCGATTTCTTCAGCAATTCATGACTATTCACTCCTCTCGATCTCCAGATTTATTCAATGATCACTCAACTATCGATAATTGCTTCGATTGAATCACTCCACAGAAGCAATTGAAAATAGATTAGCGAGATCATCACAACTGTTCATCCCTCGTAGATCTCCGATTAGATAATTCATTC...

CDS

Download CDS FASTA

669 bp · TkA02G102480|TK1151|CDS

ATGGCGACGAGGAACAGAACGTTTCTGTTTAAGAAGTATAGAGATGCATTGAAGACCGTTAGGGCTCCGTCGTCGTTAGCTTCTTCTAGCTCCCGTAGTGGTGCTGTTATCGAGATGGCCAACGCCGGTCTGCTTAAGCAAAATAGTTCTTATGCTCCTCTTAGCACCGAGGATCCCGGGACTTCCTCAACAGGTGCATTAACAGTGGGACTGCCTCCAGCATGGGTTGATGTATCTGATGAAATAGCAGCAAATGTGCA...

Protein

Download Protein FASTA

222 aa · TkA02G102480|TK1151|PROTEIN

MATRNRTFLFKKYRDALKTVRAPSSLASSSSRSGAVIEMANAGLLKQNSSYAPLSTEDPGTSSTGALTVGLPPAWVDVSDEIAANVQRARSKMGELAKAHAKALMPSFGDGKEDQHKIEALTHEITDLLKKSERRLKRLSAGGTSEDSNIRKNVQRSIATDLQSLSMELRKKQSTYLKRLQLQKEGPDGVDLEMNLNGKQSKRDDDDDEFDDMGFNEHQLAN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G102480`
TK1151 ID	TkA02G102480
OH-1004 ID	LXL04_016791
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.550 / OH-1004 68.421 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G102480

Location Chr02:26798516-26802757 (-)

Description Similar to SYP43: Syntaxin-43

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05710`	Contributes to the regulation of secretory and vacuolar transport pathways in the post-Golgi network, and to the maintenance of the Golgi apparatus and trans-Golgi network (TGN) morphologies.	Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22
`At5g26980`	Contributes to the regulation of secretory and vacuolar transport pathways in the post-Golgi network, and to the maintenance of the Golgi apparatus and trans-Golgi network (TGN) morphologies.	YKT6 is a core constituent of membrane fusion machineries at the Arabidopsis trans-Golgi network.2005 · DOI: 10.1016/j.jmb.2005.04.061 Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22
`At4g02195`	Contributes to the regulation of secretory and vacuolar transport pathways in the post-Golgi network, and to the maintenance of the Golgi apparatus and trans-Golgi network (TGN) morphologies.	Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016791 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006896 Golgi to vacuole transport Biological Process

GO:0006906 vesicle fusion Biological Process

GO:0007030 Golgi organization Biological Process

GO:0007034 vacuolar transport Biological Process

GO:0009306 protein secretion Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009863 salicylic acid mediated signaling pathway Biological Process

GO:0032456 endocytic recycling Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

GO:0043001 Golgi to plasma membrane protein transport Biological Process

GO:0048278 vesicle docking Biological Process

KEGG gene cross-reference

ath:AT3G05710

ath:AT4G02195

ath:AT5G26980

hsa:8675

mmu:228960

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.380

Rank 1 · TkA02G102480 · TK1151

Golgi apparatus0.317

Rank 2 · TkA02G102480 · TK1151

Endoplasmic reticulum0.228

Rank 3 · TkA02G102480 · TK1151

Cell membrane0.198

Rank 4 · TkA02G102480 · TK1151

Nucleus0.157

Rank 5 · TkA02G102480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14523Syntaxin_279-179 aa

PF00745GlutR_dimer82-143 aa

PF14282FlxA111-175 aa

PF30303TRAPPC10-Trs130_NTS112-181 aa

PF19286ZSWIM1-3_C114-134 aa

PF25118EFL1120-171 aa

PF07299EF-G-binding_N121-121 aa

PF00745GlutR_dimer133-172 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G102480	`PF14523`	Syntaxin_2	79	179	1.3e-05	26.0
TkA02G102480	`PF00745`	GlutR_dimer	82	143	0.21	12.6
TkA02G102480	`PF14282`	FlxA	111	175	0.0036	18.2
TkA02G102480	`PF30303`	TRAPPC10-Trs130_NTS	112	181	0.15	11.9
TkA02G102480	`PF19286`	ZSWIM1-3_C	114	134	0.11	12.9
TkA02G102480	`PF25118`	EFL1	120	171	0.025	16.0
TkA02G102480	`PF07299`	EF-G-binding_N	121	121	0.087	14.0
TkA02G102480	`PF00745`	GlutR_dimer	133	172	0.21	12.6
TkA02G102480	`PF07299`	EF-G-binding_N	140	184	0.087	14.0
TkA02G102480	`PF19286`	ZSWIM1-3_C	163	171	0.11	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SUJ1`	Arabidopsis thaliana	sp\|Q9SUJ1\|SYP43_ARATH Syntaxin-43	68.200%	Swiss-Prot	High
`O65359`	Arabidopsis thaliana	sp\|O65359\|SYP41_ARATH Tlg2p-like protein a	70.700%	Swiss-Prot	High
`Q9SWH4`	Arabidopsis thaliana	sp\|Q9SWH4\|SYP42_ARATH Syntaxin-42	63.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card