Gene Card
Gene overview
cDNA / CDS / Protein Sequences
972 bp · LXL04_016791|LXL04_016791|OH1004|cDNA
ATGGCGACGAGGAACAGAACGTTTCTGTTTAAGAAGTATAGAGATGCATTGAAGACCGTTAGGGCTCCGTCGTCGTTAGCTTCTTCTAGCTCCCGTAGTGGTGCTGTTATCGAGATGGCCAACGCCGGTCTGCTTAAGCAAAATAGTTCTTATGCTCCTCTTAGCACCGAGGATCCCGGGACTTCCTCAACAGGTGCATTAACAGTGGGACTGCCTCCAGCATGGGTTGATGTATCTGATGAAATAGCAGCAAATGTGCA...
972 bp · LXL04_016791|LXL04_016791|OH1004|CDS
ATGGCGACGAGGAACAGAACGTTTCTGTTTAAGAAGTATAGAGATGCATTGAAGACCGTTAGGGCTCCGTCGTCGTTAGCTTCTTCTAGCTCCCGTAGTGGTGCTGTTATCGAGATGGCCAACGCCGGTCTGCTTAAGCAAAATAGTTCTTATGCTCCTCTTAGCACCGAGGATCCCGGGACTTCCTCAACAGGTGCATTAACAGTGGGACTGCCTCCAGCATGGGTTGATGTATCTGATGAAATAGCAGCAAATGTGCA...
Protein
Download Protein FASTA323 aa · LXL04_016791|LXL04_016791|OH1004|PROTEIN
MATRNRTFLFKKYRDALKTVRAPSSLASSSSRSGAVIEMANAGLLKQNSSYAPLSTEDPGTSSTGALTVGLPPAWVDVSDEIAANVQRARSKMGELAKAHAKALMPSFGDGKEDQHKIEALTHEITDLLKKSERRLKRLSAGGTSEDSNIRKNVQRSIATDLQSLSMELRKKQSTYLKRLQLQKEGPDGVDLEMNLNGKQSKRDDDDDEFDDMGFNEHQLAKLKKSEAFTVEREKEIQQVVESVNELAQIMKDLSVLVID...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_016791 |
|---|---|
| TK1151 ID | TkA02G102480 |
| OH-1004 ID | LXL04_016791 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 99.550 / OH-1004 68.421Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_016791 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:133768998-133772489 (+) | ||||||||||||
| Description | Similar to SYP43: Syntaxin-43 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006886 intracellular protein transport Biological Process GO:0006896 Golgi to vacuole transport Biological Process GO:0006906 vesicle fusion Biological Process GO:0007030 Golgi organization Biological Process GO:0007034 vacuolar transport Biological Process GO:0009306 protein secretion Biological Process GO:0009658 chloroplast organization Biological Process GO:0009863 salicylic acid mediated signaling pathway Biological Process GO:0032456 endocytic recycling Biological Process GO:0042147 retrograde transport, endosome to Golgi Biological Process GO:0043001 Golgi to plasma membrane protein transport Biological Process GO:0048278 vesicle docking Biological Process | ||||||||||||
| KEGG gene cross-reference | ath:AT3G05710 ath:AT4G02195 ath:AT5G26980 hsa:8675 mmu:228960 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF05739.27SNARE232-306 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_016791 | PF05739.27 | SNARE | 232 | 306 | 5.6e-23 | 81.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.