RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G642100
Reference: TK1151 Chr: Chr01 Coordinates: 162476153-162479187 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2121 bp · TkA01G642100|TK1151|cDNA

AAAACATGAAGTTTTGGTAGAAATTTTGTTTACCGATGGCTGGCCCCATCCGTCTCCATATGCTCCGTCCGGTTCCGACCTTTCATTTGCAATTCTAGCCGACGGAGCACACCCTCTCCCTCTCTCTCTCCGGCAGAAGGTTACACACACTACACTCTGCTATTCGCCCACCTGCTTCACCTTTCTCTCTCTACCGAGCATTCTCTCTACAGGCTACACTTCCATTACTGTAGGAATATGGCTTTTTGATTTTGATTGGT...

CDS

Download CDS FASTA

1605 bp · TkA01G642100|TK1151|CDS

ATGGGGAATTGTTGCAGATCTCCAGCGTCTGTAGCCAGGGAAGATGTGAAGTCTTCAAACTACCCTGGTCATGACCATCACAACAAGAAGGACAAGACTAACGCTGGGAACGCTAAGAAGGCGCCGATCGCTGTCCTCACTGATGTGTCGAAGGAAAATATCGAAGAGAAGTATATGTTAGATAGGGAACTTGGACGCGGAGAATTTGGAGTGACTTACCTGTGTATAGATCGAAGCTCGAGGGAATTGTTAGCCTGTAA...

Protein

Download Protein FASTA

534 aa · TkA01G642100|TK1151|PROTEIN

MGNCCRSPASVAREDVKSSNYPGHDHHNKKDKTNAGNAKKAPIAVLTDVSKENIEEKYMLDRELGRGEFGVTYLCIDRSSRELLACKSISKRKLRTAVDVDDVRREVAIMKHLPENSSIVTLREACEDENAVHLVMELCEGGELFDRIVARGHYTERAAAAVTRTIVEVVQLCHKHGVIHRDLKPENFLFANKKENSPLKAIDFGLSIFFKPGERFSEIVGSPYYMAPEVLKRNYGPEIDIWSAGVILYILLCGVPPFWA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G642100
TK1151 IDTkA01G642100
OH-1004 IDLXL04_000009
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)99.800
Protein coverage (%)TK1151 99.064 / OH-1004 88.610
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G642100
LocationChr01:162476153-162479187 (+)
DescriptionSimilar to CPK13: Calcium-dependent protein kinase 13
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g51850 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
At5g12480 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
At5g19450 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0832300 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
Os05g0467000 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
Os07g0568600 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_000009 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0035556 intracellular signal transduction Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009536 plastid Cellular Component
GO:0004672 protein kinase activity Molecular Function
GO:0004674 protein serine/threonine kinase activity Molecular Function
GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function
GO:0005509 calcium ion binding Molecular Function
KEGG gene cross-reference
ath:AT1G74740
ath:AT3G51850
ath:AT5G12480
dosa:Os01g0832300
dosa:Os05g0467000
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.574
Rank 1 · TkA01G642100 · TK1151
Cytoplasm0.309
Rank 2 · TkA01G642100 · TK1151
Nucleus0.204
Rank 3 · TkA01G642100 · TK1151
Golgi apparatus0.063
Rank 4 · TkA01G642100 · TK1151
Endoplasmic reticulum0.058
Rank 5 · TkA01G642100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase59-316 aa
PF07714PK_Tyr_Ser-Thr60-312 aa
PF06293Kdo87-204 aa
PF26389MamY_C94-138 aa
PF01636APH98-160 aa
PF01163RIO1103-193 aa
PF03109ABC1134-215 aa
PF14531Kinase-like147-300 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G642100PF00069Pkinase593161.8e-75254.4
TkA01G642100PF07714PK_Tyr_Ser-Thr603123.7e-2486.2
TkA01G642100PF06293Kdo872040.0001621.9
TkA01G642100PF26389MamY_C941380.4511.0
TkA01G642100PF01636APH981600.03214.7
TkA01G642100PF01163RIO11031930.04614.1
TkA01G642100PF03109ABC11342150.0001821.5
TkA01G642100PF14531Kinase-like1473000.0004820.2
TkA01G642100PF20742DUF5580_M1681790.09213.5
TkA01G642100PF17667Pkinase_fungal1692350.01814.5
TkA01G642100PF01636APH1742050.03214.7
TkA01G642100PF29176Allatotropin-like_C2662770.002618.0
TkA01G642100PF26389MamY_C3303770.4511.0
TkA01G642100PF13833EF-hand_83533843.3e-1349.9
TkA01G642100PF12763EH3564333.2e-0627.7
TkA01G642100PF25825SAPC2_N3574236.9e-0626.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8W4I7Arabidopsis thalianasp|Q8W4I7|CDPKD_ARATH Calcium-dependent protein kinase 1386.000%Swiss-ProtHigh
Q38873Arabidopsis thalianasp|Q38873|CDPK7_ARATH Calcium-dependent protein kinase 766.200%Swiss-ProtHigh
Q42438Arabidopsis thalianasp|Q42438|CDPK8_ARATH Calcium-dependent protein kinase 866.600%Swiss-ProtHigh
Q8LPZ7Oryza sativa subsp. japonicasp|Q8LPZ7|CDPK3_ORYSJ Calcium-dependent protein kinase 377.700%Swiss-ProtHigh
Q6I5I8Oryza sativa subsp. japonicasp|Q6I5I8|CDPKG_ORYSJ Calcium-dependent protein kinase 1678.000%Swiss-ProtHigh
Q84SL0Oryza sativa subsp. japonicasp|Q84SL0|CDPKK_ORYSJ Calcium-dependent protein kinase 2071.500%Swiss-ProtHigh

JBrowse

View in Genome Browser