LXL04_000009 | RubberDandelionOmics

Gene overview

LXL04_000009

Reference: OH-1004 Chr: Chr01 Coordinates: 196967-200475 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1794 bp · LXL04_000009|LXL04_000009|OH1004|cDNA

ATGAAGCGTGAAGTGACTTCGGCCTCTGTTACACCAGCAAGAGTGATTCCACCATTAGTTGTTTCCCTTATTTGCAGAGGAGCCCTAGATAGCTCTACAACTCTTCCAGTCTCATCTATCTTGGTAATAGGGCCAATGGAAGAATCGAACCGGAGAAAACAAAAGAATATGAAATGGTTGCTACAGATTCTCTTCGTTAAGCTAAGATCTCCAGCGTCTGTAGCCAGGGAAGATGTGAAGTCTTCAAACTACTCCGGTCA...

CDS

Download CDS FASTA

1794 bp · LXL04_000009|LXL04_000009|OH1004|CDS

ATGAAGCGTGAAGTGACTTCGGCCTCTGTTACACCAGCAAGAGTGATTCCACCATTAGTTGTTTCCCTTATTTGCAGAGGAGCCCTAGATAGCTCTACAACTCTTCCAGTCTCATCTATCTTGGTAATAGGGCCAATGGAAGAATCGAACCGGAGAAAACAAAAGAATATGAAATGGTTGCTACAGATTCTCTTCGTTAAGCTAAGATCTCCAGCGTCTGTAGCCAGGGAAGATGTGAAGTCTTCAAACTACTCCGGTCA...

Protein

Download Protein FASTA

597 aa · LXL04_000009|LXL04_000009|OH1004|PROTEIN

MKREVTSASVTPARVIPPLVVSLICRGALDSSTTLPVSSILVIGPMEESNRRKQKNMKWLLQILFVKLRSPASVAREDVKSSNYSGHDHHNKKDKTNAGNAKKAPIAVLTDVSKENIEEKYMLDRELGRGEFGVTYLCIDRSSRELLACKSISKRKLRTAVDVDDVRREVAIMKHLPENSSIVTLREACEDENAVHLVMELCEGGELFDRIVARGHYTERAAAAVTRTIVEVVQLCHKHGVIHRDLKPENFLFANKKENS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000009`
TK1151 ID	TkA01G642100
OH-1004 ID	LXL04_000009
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.800
Protein coverage (%)	TK1151 99.064 / OH-1004 88.610 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000009

Location Chr01:196967-200475 (-)

Description Similar to CPK13: Calcium-dependent protein kinase 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51850`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At5g12480`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At1g74740`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0467000`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`Os01g0832300`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000009 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G74740

ath:AT3G51850

ath:AT5G12480

dosa:Os01g0832300

dosa:Os05g0467000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.481

Rank 1 · LXL04_000009 · OH-1004

Cytoplasm0.258

Rank 2 · LXL04_000009 · OH-1004

Nucleus0.183

Rank 3 · LXL04_000009 · OH-1004

Endoplasmic reticulum0.084

Rank 4 · LXL04_000009 · OH-1004

Golgi apparatus0.082

Rank 5 · LXL04_000009 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase122-379 aa

PF07714.24PK_Tyr_Ser-Thr123-375 aa

PF13499.13EF-hand_7425-486 aa

PF00036.39EF-hand_1426-453 aa

PF13405.13EF-hand_6426-454 aa

PF13202.13EF-hand_5427-449 aa

PF13499.13EF-hand_7497-560 aa

PF00036.39EF-hand_1499-524 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000009	`PF00069.32`	Pkinase	122	379	2.4e-75	254.0
LXL04_000009	`PF07714.24`	PK_Tyr_Ser-Thr	123	375	4.7e-24	85.8
LXL04_000009	`PF13499.13`	EF-hand_7	425	486	1.1e-26	93.6
LXL04_000009	`PF00036.39`	EF-hand_1	426	453	2.3e-29	99.4
LXL04_000009	`PF13405.13`	EF-hand_6	426	454	2.3e-24	83.4
LXL04_000009	`PF13202.13`	EF-hand_5	427	449	2.2e-23	81.3
LXL04_000009	`PF13499.13`	EF-hand_7	497	560	1.1e-26	93.6
LXL04_000009	`PF00036.39`	EF-hand_1	499	524	2.3e-29	99.4
LXL04_000009	`PF13405.13`	EF-hand_6	499	525	2.3e-24	83.4
LXL04_000009	`PF13202.13`	EF-hand_5	501	523	2.2e-23	81.3
LXL04_000009	`PF13833.13`	EF-hand_8	532	560	4.4e-13	49.5
LXL04_000009	`PF00036.39`	EF-hand_1	536	561	2.3e-29	99.4
LXL04_000009	`PF13405.13`	EF-hand_6	537	560	2.3e-24	83.4
LXL04_000009	`PF13202.13`	EF-hand_5	537	559	2.2e-23	81.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W4I7`	Arabidopsis thaliana	Calcium-dependent protein kinase 13	85.932%	Swiss-Prot	strong database homology
`Q38873`	Arabidopsis thaliana	Calcium-dependent protein kinase 7	68.800%	Swiss-Prot	strong database homology
`Q9SSF8`	Arabidopsis thaliana	Calcium-dependent protein kinase 30	70.348%	Swiss-Prot	strong database homology
`Q6I5I8`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 16	78.189%	Swiss-Prot	strong database homology
`Q8LPZ7`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 3	77.248%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card