TkA01G569500 | RubberDandelionOmics

Gene overview

TkA01G569500

Reference: TK1151 Chr: Chr01 Coordinates: 143345273-143347105 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1557 bp · TkA01G569500|TK1151|cDNA

ATGGCTAATAAAATCATCATCTCCGTCGTATCCTTGGTCTTGGTGGTCGCGGCCGTTCTCGGTGTGGTGGCTTTCATCGTGAAAAGCGGCGAATCCGATAAAAACATTTCCACTAGCAATAAGGCGGTCGACAGTGTTTGCAAACCGACAGAATACAAAGAGGCGTGCAATAAAGTAGCAATCGAGGTGTCCAAAAACGAATCGGCCACCCACGAGGACTACATTATTGCCACCATCCGTGCAACTGCGGATGAACTACA...

CDS

Download CDS FASTA

1557 bp · TkA01G569500|TK1151|CDS

ATGGCTAATAAAATCATCATCTCCGTCGTATCCTTGGTCTTGGTGGTCGCGGCCGTTCTCGGTGTGGTGGCTTTCATCGTGAAAAGCGGCGAATCCGATAAAAACATTTCCACTAGCAATAAGGCGGTCGACAGTGTTTGCAAACCGACAGAATACAAAGAGGCGTGCAATAAAGTAGCAATCGAGGTGTCCAAAAACGAATCGGCCACCCACGAGGACTACATTATTGCCACCATCCGTGCAACTGCGGATGAACTACA...

Protein

Download Protein FASTA

518 aa · TkA01G569500|TK1151|PROTEIN

MANKIIISVVSLVLVVAAVLGVVAFIVKSGESDKNISTSNKAVDSVCKPTEYKEACNKVAIEVSKNESATHEDYIIATIRATADELQKALKKASTKKAETCEKMLGYAKDELEQVLKVVSETEAVSLAQQIDPILVWLTAIRGYQTTCVDEINDEKLKKDMQKGLETSNELTYNAQKIVYNVLDILKDIGIDLGDIPKVTPNAIVAKDGSGKFKSIKQALAAYPPNHQGRYIIYVKAGVYSEGQIIVGKTQNNVYMYGDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G569500`
TK1151 ID	TkA01G569500
OH-1004 ID	LXL04_037131
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	46.600
Protein coverage (%)	TK1151 100.000 / OH-1004 99.665 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G569500

Location Chr01:143345273-143347105 (+)

Description Similar to BP19: Probable pectinesterase/pectinesterase inhibitor

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g33230`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At2g47030`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At5g49180`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At2g26450`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At2g47040`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	VANGUARD1 encodes a pectin methylesterase that enhances pollen tube growth in the Arabidopsis style and transmitting tract.2005 · DOI: 10.1105/tpc.104.027631

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037131 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009860 pollen tube growth Biological Process

GO:0042545 cell wall modification Biological Process

GO:0045490 pectin catabolic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0004857 enzyme inhibitor activity Molecular Function

GO:0030599 pectinesterase activity Molecular Function

GO:0046910 pectinesterase inhibitor activity Molecular Function

KEGG gene cross-reference

ath:AT2G26450

ath:AT2G47040

ath:AT4G33230

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.484

Rank 1 · TkA01G569500 · TK1151

Cell membrane0.197

Rank 2 · TkA01G569500 · TK1151

Lysosome / Vacuole0.123

Rank 3 · TkA01G569500 · TK1151

Cytoplasm0.117

Rank 4 · TkA01G569500 · TK1151

Endoplasmic reticulum0.113

Rank 5 · TkA01G569500 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04043PMEI42-176 aa

PF07499RuvA_C49-75 aa

PF24235RHG29_45_N77-119 aa

PF10078DUF231679-120 aa

PF07499RuvA_C83-102 aa

PF07499RuvA_C104-127 aa

PF01095Pectinesterase121-147 aa

PF24235RHG29_45_N155-189 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G569500	`PF04043`	PMEI	42	176	1.2e-16	62.0
TkA01G569500	`PF07499`	RuvA_C	49	75	1.5	10.1
TkA01G569500	`PF24235`	RHG29_45_N	77	119	0.14	13.2
TkA01G569500	`PF10078`	DUF2316	79	120	0.099	13.6
TkA01G569500	`PF07499`	RuvA_C	83	102	1.5	10.1
TkA01G569500	`PF07499`	RuvA_C	104	127	1.5	10.1
TkA01G569500	`PF01095`	Pectinesterase	121	147	6.2e-109	364.1
TkA01G569500	`PF24235`	RHG29_45_N	155	189	0.14	13.2
TkA01G569500	`PF10078`	DUF2316	165	198	0.099	13.6
TkA01G569500	`PF01095`	Pectinesterase	202	501	6.2e-109	364.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SMY6`	Arabidopsis thaliana	sp\|Q9SMY6\|PME45_ARATH Putative pectinesterase/pectinesterase inhibitor 45	38.600%	Swiss-Prot	Medium
`O80722`	Arabidopsis thaliana	sp\|O80722\|PME4_ARATH Pectinesterase 4	35.400%	Swiss-Prot	Medium
`Q9FJ21`	Arabidopsis thaliana	sp\|Q9FJ21\|PME58_ARATH Probable pectinesterase/pectinesterase inhibitor 58	37.600%	Swiss-Prot	Medium
`Q7Y201`	Arabidopsis thaliana	sp\|Q7Y201\|PME13_ARATH Probable pectinesterase/pectinesterase inhibitor 13	37.900%	Swiss-Prot	Medium
`Q5MFV8`	Arabidopsis thaliana	sp\|Q5MFV8\|PME5_ARATH Pectinesterase 5	34.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card