TkA01G210830 | RubberDandelionOmics

Gene overview

TkA01G210830

Reference: TK1151 Chr: Chr01 Coordinates: 53640624-53648169 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1563 bp · TkA01G210830|TK1151|cDNA

AAAAAATATTAATTGACTTGATCCATGAACTTACGATGGTGCGTGGCGTTTTTAGAAAGCTCGTTTACCCCCTTGCCCTAAATACCTAAATCGAGGAAAGTAAACTGAATTCGGGTCCATAAGTTCCTTCGACAACCTCCAATTCGTGTTTCTGCGTGTCTGAATTACTTGGAATCGAAGTCTCGGACCCATAATTTGAAGAACTCGTATACCTATAATTCAACAAATCAGTCACAATGCTCTTTAACCCCTAAAATTTC...

CDS

Download CDS FASTA

1077 bp · TkA01G210830|TK1151|CDS

ATGGATCCGAAGAAGAAATCCGTCAAAGAAAAGAACACCAATCGCGAGGAGATAGTGAAGATCATTCACTGGGAAGATTTTCAACAGGAGCTTGCTCGTCTTTCGAGTCTGTCGTCCGCCCTTAACGAAGCTAAGGAGAAGAAGTCTGTTATTCAAGAGAAACTCAACTCTCATTTACAGTTAGAAGCAGAGTCATTAAGTCGATCAAATAAGCTAGACCAAATGCGGGAAAATTTAGAAGCTCGAAAGTTGGTTATGGG...

Protein

Download Protein FASTA

358 aa · TkA01G210830|TK1151|PROTEIN

MDPKKKSVKEKNTNREEIVKIIHWEDFQQELARLSSLSSALNEAKEKKSVIQEKLNSHLQLEAESLSRSNKLDQMRENLEARKLVMGNMSMRSKVVQEKSKKQEEQLNSQIRSLLMAGTSLSAASKSLQEANNSLNGERGYVHLRNLQKLLRGRQQFMVSQIALLYPVKVVTGHTSDQELESFSSTSNKLTGNPSGSKPMDNAAGSLTISGLHLTVLPFKKMSFFTDKKEVQRSATALGYVAHAISLIAFYLEIPLRYPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G210830`
TK1151 ID	TkA01G210830
OH-1004 ID	LXL04_004027
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G210830

Location Chr01:53640624-53648169 (-)

Description Similar to UVRAG: UV radiation resistance-associated gene protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g32760`	Dispensable for autophagy but essential for efficient targeting and degradation of biosynthetic and endocytic cargo to the vacuole.	Vacuolar Trafficking Protein VPS38 Is Dispensable for Autophagy.2018 · DOI: 10.1104/pp.17.01297 The Arabidopsis USL1 controls multiple aspects of development by affecting late endosome morphology.2018 · DOI: 10.1111/nph.15249

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004027 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006623 protein targeting to vacuole Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0006914 autophagy Biological Process

GO:0007051 spindle organization Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0007098 centrosome cycle Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010506 regulation of autophagy Biological Process

GO:0015031 protein transport Biological Process

GO:0032465 regulation of cytokinesis Biological Process

GO:0032801 receptor catabolic process Biological Process

KEGG gene cross-reference

ath:AT2G32760

hsa:7405

mmu:78610

spo:2540836

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.550

Rank 1 · TkA01G210830 · TK1151

Nucleus0.305

Rank 2 · TkA01G210830 · TK1151

Golgi apparatus0.123

Rank 3 · TkA01G210830 · TK1151

Cell membrane0.114

Rank 4 · TkA01G210830 · TK1151

Lysosome / Vacuole0.103

Rank 5 · TkA01G210830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16789YscO-like3-46 aa

PF10186ATG149-294 aa

PF02601Exonuc_VII_L20-156 aa

PF16789YscO-like52-134 aa

PF19187HTH_PafC96-191 aa

PF18706ISPD_C104-191 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G210830	`PF16789`	YscO-like	3	46	0.7	10.6
TkA01G210830	`PF10186`	ATG14	9	294	0.0032	17.4
TkA01G210830	`PF02601`	Exonuc_VII_L	20	156	1.5	8.9
TkA01G210830	`PF16789`	YscO-like	52	134	0.7	10.6
TkA01G210830	`PF19187`	HTH_PafC	96	191	0.081	13.5
TkA01G210830	`PF18706`	ISPD_C	104	191	0.004	17.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S9J3`	Arabidopsis thaliana	sp\|Q8S9J3\|VPS38_ARATH Vacuolar protein sorting 38	57.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card