LXL04_020884 | RubberDandelionOmics

Gene overview

LXL04_020884

Reference: OH-1004 Chr: Chr04 Coordinates: 112840458-112842559 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1134 bp · LXL04_020884|LXL04_020884|OH1004|cDNA

ATGAAGGTTTTATTGAAGACATTGGAGTCCCTAAGACCCCTTGCAGTAACCAAGGCATGGGACTATTGCGTTGTTTGGAAGTTCGACGATGATCCTTCAGGGTATATCGAGTGGATTGGATGCTGTTGCAGTGGTAGTCATGGTGTTTGTAAAAATGTCAAAGAGGAAAACGATGAAATCGAGCTCAATGTGCCTTACCTCTGCAAAGATACTTACGTTAAACACACCGTCAGGACAAAAGCTTGTGAAAAACTCGCCGT...

CDS

Download CDS FASTA

1134 bp · LXL04_020884|LXL04_020884|OH1004|CDS

ATGAAGGTTTTATTGAAGACATTGGAGTCCCTAAGACCCCTTGCAGTAACCAAGGCATGGGACTATTGCGTTGTTTGGAAGTTCGACGATGATCCTTCAGGGTATATCGAGTGGATTGGATGCTGTTGCAGTGGTAGTCATGGTGTTTGTAAAAATGTCAAAGAGGAAAACGATGAAATCGAGCTCAATGTGCCTTACCTCTGCAAAGATACTTACGTTAAACACACCGTCAGGACAAAAGCTTGTGAAAAACTCGCCGT...

Protein

Download Protein FASTA

377 aa · LXL04_020884|LXL04_020884|OH1004|PROTEIN

MKVLLKTLESLRPLAVTKAWDYCVVWKFDDDPSGYIEWIGCCCSGSHGVCKNVKEENDEIELNVPYLCKDTYVKHTVRTKACEKLAVIPCSLPLYPGIHGKVAMSKQPIWLSNDSIGTQLIVPVDGGLIELFKSKHVPMDQTMIETLISRLGHGFHENDMKTGMNPYHYHQIVPKLAHGKEIIKTKEEYNSKNLVTERNRRKRIKDGLYTLRALVPRISKMDKASIVGDAVEYIKELEKNVKQLQQEVKELQQQDSKAND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020884`
TK1151 ID	TkA05G325770
OH-1004 ID	LXL04_020884
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	93.500
Protein coverage (%)	TK1151 100.000 / OH-1004 55.703 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020884

Location Chr04:112840458-112842559 (+)

Description Similar to BHLH90: Transcription factor bHLH90

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g10610`	Transcription factor bHLH90.	No verified direct reference in this release
`At2g16910`	Transcription factor.	No verified direct reference in this release
`At5g57150`	Transcription factor bHLH35.	No verified direct reference in this release
`At4g21330`	Transcription factor.	Regulation of Arabidopsis tapetum development and function by DYSFUNCTIONAL TAPETUM1 (DYT1) encoding a putative bHLH transcription factor.2006 · DOI: 10.1242/dev.02463

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0120500`	Transcription factor involved in the regulation of tapetum programmed cell death (PCD) and degradation during male reproductive development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020884 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009555 pollen development Biological Process

GO:0048653 anther development Biological Process

GO:0048654 anther morphogenesis Biological Process

GO:0048657 anther wall tapetum cell differentiation Biological Process

GO:0048658 anther wall tapetum development Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003682 chromatin binding Molecular Function

KEGG gene cross-reference

ath:AT1G10610

ath:AT2G16910

dosa:Os02g0120500

osa:4328113

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.843

Rank 1 · LXL04_020884 · OH-1004

Cytoplasm0.204

Rank 2 · LXL04_020884 · OH-1004

Cell membrane0.063

Rank 3 · LXL04_020884 · OH-1004

Endoplasmic reticulum0.037

Rank 4 · LXL04_020884 · OH-1004

Lysosome / Vacuole0.014

Rank 5 · LXL04_020884 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14215.13bHLH-MYC_N9-146 aa

PF00010.32HLH195-238 aa

PF23177.2bHLH_IRO3195-254 aa

PF22754.5bHLH-TF_ACT-like_plant295-365 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020884	`PF14215.13`	bHLH-MYC_N	9	146	6.4e-16	59.9
LXL04_020884	`PF00010.32`	HLH	195	238	1.9e-11	44.3
LXL04_020884	`PF23177.2`	bHLH_IRO3	195	254	2.3e-06	28.6
LXL04_020884	`PF22754.5`	bHLH-TF_ACT-like_plant	295	365	5.1e-10	40.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WNR2`	Arabidopsis thaliana	Transcription factor bHLH90	34.419%	Swiss-Prot	moderate database homology
`Q9ZVX2`	Arabidopsis thaliana	Transcription factor ABORTED MICROSPORES	39.394%	Swiss-Prot	weak database homology
`Q2HIV9`	Arabidopsis thaliana	Transcription factor bHLH35	33.333%	Swiss-Prot	weak database homology
`O81900`	Arabidopsis thaliana	Transcription factor DYT1	35.922%	Swiss-Prot	moderate database homology
`Q6YUS3`	Oryza sativa subsp. japonica	Transcription factor TDR	33.846%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card