LXL04_013400 | RubberDandelionOmics

Gene overview

LXL04_013400

Reference: OH-1004 Chr: Chr03 Coordinates: 29028651-29032944 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3186 bp · LXL04_013400|LXL04_013400|OH1004|cDNA

CGGAAACAACTCGACAAGCCTCGCGCTCTCTTGAACCATCCTCTTCCTTCTTCTTATATATTAACTGTGTCAACTCTCTCCTCCACTCATCACTTCACTCACAAGTTTTGCCTTGGAACTTACCAGAACCCTTATCTTTCCCGTATTCCCACTCAATCCCCTCTACTTTTTCATTCCTTGATCTCTCCCAATAACCTTGATTTACTGGTCACTCGACTCACACTTCTTCCGTTACCGATGGCAACGACGGCGTCCTTCTC...

CDS

Download CDS FASTA

3156 bp · LXL04_013400|LXL04_013400|OH1004|CDS

TTGAACCATCCTCTTCCTTCTTCTTATATATTAACTGTGTCAACTCTCTCCTCCACTCATCACTTCACTCACAAGTTTTGCCTTGGAACTTACCAGAACCCTTATCTTTCCCGTATTCCCACTCAATCCCCTCTACTTTTTCATTCCTTGATCTCTCCCAATAACCTTGATTTACTGGTCACTCGACTCACACTTCTTCCGTTACCGATGGCAACGACGGCGTCCTTCTCCGGCGTCCGCATCCACGCTCCATCCTCCAC...

Protein

Download Protein FASTA

1051 aa · LXL04_013400|LXL04_013400|OH1004|PROTEIN

MNHPLPSSYILTVSTLSSTHHFTHKFCLGTYQNPYLSRIPTQSPLLFHSLISPNNLDLLVTRLTLLPLPMATTASFSGVRIHAPSSTCIDRTTLFAQPSVSFSSFSKPRRTTLRSLKLRSRSNDVLLRTRTGDRFGGKSSRSFVVRCDASSNGRITQQEFTEMAWQAIVSSPEVAKENKHQIVETEHLMKALLEQKNGLARRIFSKAGIDNTRLLEATDKYIQRQPKVIGESAGSMLGRDLEALMQRARDFKKEYGDSFV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013400`
TK1151 ID	TkA02G498240
OH-1004 ID	LXL04_013400
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 99.057 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013400

Location Chr03:29028651-29032944 (+)

Description Similar to CLPB3: Chaperone protein ClpB3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g15450`	Molecular chaperone essential for chloroplast development and seedling viability.	An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.2006 · DOI: 10.1111/j.1365-313x.2006.02873.x The Arabidopsis ClpB/Hsp100 family of proteins: chaperones for stress and chloroplast development.2007 · DOI: 10.1111/j.1365-313x.2006.02940.x
`At2g25140`	Molecular chaperone that does not seem to be involved in heat stress response or tolerance.	The Arabidopsis ClpB/Hsp100 family of proteins: chaperones for stress and chloroplast development.2007 · DOI: 10.1111/j.1365-313x.2006.02940.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0426900`	Molecular chaperone that may play a role in chloroplast development.	No verified direct reference in this release
`Os02g0181900`	Molecular chaperone that may not be involved in heat stress response or tolerance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013400 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009408 response to heat Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0042026 protein refolding Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009532 plastid stroma Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ana:alr5084

ath:AT2G25140

ath:AT5G15450

dosa:Os02g0181900

dosa:Os03g0426900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.944

Rank 1 · LXL04_013400 · OH-1004

Mitochondrion0.074

Rank 2 · LXL04_013400 · OH-1004

Cytoplasm0.031

Rank 3 · LXL04_013400 · OH-1004

Nucleus0.025

Rank 4 · LXL04_013400 · OH-1004

Peroxisome0.022

Rank 5 · LXL04_013400 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02861.26Clp_N159-282 aa

PF23569.2NBD_SMAX1339-441 aa

PF00004.36AAA357-488 aa

PF17871.8AAA_lid_9496-598 aa

PF00158.33Sigma54_activat752-877 aa

PF07724.21AAA_2754-922 aa

PF07728.21AAA_5759-880 aa

PF00004.36AAA760-876 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013400	`PF02861.26`	Clp_N	159	282	4.4e-35	121.4
LXL04_013400	`PF23569.2`	NBD_SMAX1	339	441	2e-06	28.5
LXL04_013400	`PF00004.36`	AAA	357	488	3e-24	86.7
LXL04_013400	`PF17871.8`	AAA_lid_9	496	598	8.3e-34	116.4
LXL04_013400	`PF00158.33`	Sigma54_activat	752	877	1.5e-09	38.5
LXL04_013400	`PF07724.21`	AAA_2	754	922	2.5e-73	246.3
LXL04_013400	`PF07728.21`	AAA_5	759	880	6.4e-19	69.1
LXL04_013400	`PF00004.36`	AAA	760	876	3e-24	86.7
LXL04_013400	`PF10431.16`	ClpB_D2-small	929	1009	8.9e-26	90.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LF37`	Arabidopsis thaliana	Chaperone protein ClpB3, chloroplastic	84.958%	Swiss-Prot	strong database homology
`Q8VYJ7`	Arabidopsis thaliana	Chaperone protein ClpB4, mitochondrial	68.247%	Swiss-Prot	strong database homology
`Q75GT3`	Oryza sativa subsp. japonica	Chaperone protein ClpB2, chloroplastic	85.667%	Swiss-Prot	strong database homology
`Q0E3C8`	Oryza sativa subsp. japonica	Chaperone protein ClpB3, mitochondrial	70.674%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card