LXL04_012704 | RubberDandelionOmics

Gene overview

LXL04_012704

Reference: OH-1004 Chr: Chr03 Coordinates: 17359673-17363297 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2607 bp · LXL04_012704|LXL04_012704|OH1004|cDNA

ATGACTCCCTCAACTTCGCCGGAGGTCTGTCCCTACAGAGACACGGAGGAGGAGCTTGTCCTTCGCGATAGTTTGCCATATATCCAGCGCTTGACGATGAAGACGACGCCATCGAATGATGTTCCTTGTGCAAAATACGGGATGGATGTATCAACTTCGTTAATCCGTTTATTCTACGCCATGAGTGATCAACCTGAATCATCCGACCCCAAGGGGACTAAGCGGGATTTTAGTACCGCGATTCTTGAGCGAAAGAAGGC...

CDS

Download CDS FASTA

2607 bp · LXL04_012704|LXL04_012704|OH1004|CDS

ATGACTCCCTCAACTTCGCCGGAGGTCTGTCCCTACAGAGACACGGAGGAGGAGCTTGTCCTTCGCGATAGTTTGCCATATATCCAGCGCTTGACGATGAAGACGACGCCATCGAATGATGTTCCTTGTGCAAAATACGGGATGGATGTATCAACTTCGTTAATCCGTTTATTCTACGCCATGAGTGATCAACCTGAATCATCCGACCCCAAGGGGACTAAGCGGGATTTTAGTACCGCGATTCTTGAGCGAAAGAAGGC...

Protein

Download Protein FASTA

868 aa · LXL04_012704|LXL04_012704|OH1004|PROTEIN

MTPSTSPEVCPYRDTEEELVLRDSLPYIQRLTMKTTPSNDVPCAKYGMDVSTSLIRLFYAMSDQPESSDPKGTKRDFSTAILERKKAANRLVVDEAINDDNSVVSMHPETMEKLQLFRGDTILIKGKKRRDTICIALADDTCEEPKIRMNKVVRSNLRVRLGDVISVHQCADVKYGKRVHILPIDDTIEGVTGNLFDAYLKPYFLEAYRPVRKGDYFLVRGGMRSVEFKVIETEPAEYCVVAPDTEIFCEGDPVIREDED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012704`
TK1151 ID	TkA02G544050
OH-1004 ID	LXL04_012704
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 93.088 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012704

Location Chr03:17359673-17363297 (-)

Description Similar to CDC48: Cell division cycle protein 48 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03340`	Probably functions in cell division and growth processes.	No verified direct reference in this release
`At3g53230`	Probably functions in cell division and growth processes.	No verified direct reference in this release
`At3g09840`	Probably functions in cell division and growth processes (Probable).	Ubiquitin-dependent chloroplast-associated protein degradation in plants.2019 · DOI: 10.1126/science.aav4467 The CDC48 complex mediates ubiquitin-dependent degradation of intra-chloroplast proteins in plants.2022 · DOI: 10.1016/j.celrep.2022.110664

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012704 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010498 proteasomal protein catabolic process Biological Process

GO:0030162 regulation of proteolysis Biological Process

GO:0030970 retrograde protein transport, ER to cytosol Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0031648 protein destabilization Biological Process

GO:0034614 cellular response to reactive oxygen species Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0045732 positive regulation of protein catabolic process Biological Process

GO:0051228 mitotic spindle disassembly Biological Process

KEGG gene cross-reference

ath:AT3G09840

ath:AT3G53230

ath:AT5G03340

cann:107847567

gmx:547850

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.585

Rank 1 · LXL04_012704 · OH-1004

Nucleus0.389

Rank 2 · LXL04_012704 · OH-1004

Cell membrane0.086

Rank 3 · LXL04_012704 · OH-1004

Endoplasmic reticulum0.077

Rank 4 · LXL04_012704 · OH-1004

Mitochondrion0.057

Rank 5 · LXL04_012704 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02359.25CDC48_N90-171 aa

PF02933.24CDC48_2191-254 aa

PF05496.19RuvB_N304-379 aa

PF00004.36AAA305-434 aa

PF13671.13AAA_33305-365 aa

PF07728.21AAA_5305-423 aa

PF17862.8AAA_lid_3457-498 aa

PF05496.19RuvB_N576-611 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012704	`PF02359.25`	CDC48_N	90	171	6.5e-23	81.4
LXL04_012704	`PF02933.24`	CDC48_2	191	254	1.5e-11	44.5
LXL04_012704	`PF05496.19`	RuvB_N	304	379	1.6e-13	51.5
LXL04_012704	`PF00004.36`	AAA	305	434	2e-97	323.4
LXL04_012704	`PF13671.13`	AAA_33	305	365	1.8e-10	42.0
LXL04_012704	`PF07728.21`	AAA_5	305	423	1.6e-09	38.6
LXL04_012704	`PF17862.8`	AAA_lid_3	457	498	1.4e-30	105.1
LXL04_012704	`PF05496.19`	RuvB_N	576	611	1.6e-13	51.5
LXL04_012704	`PF13191.13`	AAA_16	576	684	2.8e-11	44.9
LXL04_012704	`PF00004.36`	AAA	578	711	2e-97	323.4
LXL04_012704	`PF17862.8`	AAA_lid_3	733	773	1.4e-30	105.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZF6`	Arabidopsis thaliana	Cell division control protein 48 homolog E	90.999%	Swiss-Prot	strong database homology
`Q9SCN8`	Arabidopsis thaliana	Cell division control protein 48 homolog D	90.330%	Swiss-Prot	strong database homology
`P54609`	Arabidopsis thaliana	Cell division control protein 48 homolog A	91.353%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card