TkA06G366950 | RubberDandelionOmics

Gene overview

TkA06G366950

Reference: TK1151 Chr: Chr06 Coordinates: 90868792-90871877 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2261 bp · TkA06G366950|TK1151|cDNA

ACTTAACTGTATAATCTGAGGATTATTTGTTAATCTGTAATCTACCATTGGACCTGTGAATACATGAAAATCCATACACCATTCCCATCCCTATAATCCCTCCCGATCATTCCCTCCAAAAATCATCTCGTTTCCACACCACTATCATCGATCCCTTTTGCAATCTGTCTTGACCTTTCTCTCTCTGTTTCTCTTTCTCTCTGTATCCATCCCTCTGTTTCACCGACTCTCACTTTCTTTCTCTCTAAACCTTCCATTTT...

CDS

Download CDS FASTA

1509 bp · TkA06G366950|TK1151|CDS

ATGGGGAACTGCTGTTCCCAAAAAGAACCTCCAACTGAAGATGGGCAACCAAAAACAGAGGAAAGTCCCGAAGAAAGATCCGGAAACGACCCATCAAGAACCACCCCTCAAAGTGCATCCTCTCCGACAAACAAACCCGGCAAGCCATCCCCTATCGGAACCGTCTTGGGCCGCCCAATGGAAGATGTCCGTACAAGCTATACAATCGGAAAAGAGCTTGGTCGCGGCCAATTTGGTGTTACCCATTTATGCACGAATAA...

Protein

Download Protein FASTA

502 aa · TkA06G366950|TK1151|PROTEIN

MGNCCSQKEPPTEDGQPKTEESPEERSGNDPSRTTPQSASSPTNKPGKPSPIGTVLGRPMEDVRTSYTIGKELGRGQFGVTHLCTNKQTGEQFACKTIAKRKLVNTEDMEDVRREVQIMHHLSGQNNIVDLKGAFEDKHSVHLVMELCAGGELFDRIIAKGHYTERGAASLLRTIVQIVHTCHSMGVIHRDLKPENFLLLSKDENAPLKATDFGLSVFYKQGEVFSDIVGSAYYIAPEVLKRKYGPEVDIWSIGVMLYIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G366950`
TK1151 ID	TkA06G366950
OH-1004 ID	LXL04_027077
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	63.400
Protein coverage (%)	TK1151 88.247 / OH-1004 82.189 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G366950

Location Chr06:90868792-90871877 (+)

Description Similar to CPK21: Calcium-dependent protein kinase 21

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g12180`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At5g19360`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At4g23650`	May play a role in signal transduction pathways that involve calcium as a second messenger.	CDPKs CPK6 and CPK3 function in ABA regulation of guard cell S-type anion- and Ca(2+)-permeable channels and stomatal closure.2006 · DOI: 10.1371/journal.pbio.0040327

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0808400`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`Os05g0491900`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027077 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G20410

ath:AT4G04720

ath:AT4G21940

dosa:Os07g0515100

osa:4343373

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.445

Rank 1 · TkA06G366950 · TK1151

Cell membrane0.431

Rank 2 · TkA06G366950 · TK1151

Nucleus0.213

Rank 3 · TkA06G366950 · TK1151

Golgi apparatus0.134

Rank 4 · TkA06G366950 · TK1151

Endoplasmic reticulum0.090

Rank 5 · TkA06G366950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase67-325 aa

PF07714PK_Tyr_Ser-Thr68-320 aa

PF14531Kinase-like71-125 aa

PF05042Caleosin116-144 aa

PF06293Kdo142-206 aa

PF14531Kinase-like162-310 aa

PF06293Kdo345-369 aa

PF13833EF-hand_8365-393 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G366950	`PF00069`	Pkinase	67	325	1.2e-78	264.8
TkA06G366950	`PF07714`	PK_Tyr_Ser-Thr	68	320	7.2e-28	98.3
TkA06G366950	`PF14531`	Kinase-like	71	125	7.2e-07	29.5
TkA06G366950	`PF05042`	Caleosin	116	144	0.063	13.9
TkA06G366950	`PF06293`	Kdo	142	206	0.00065	19.9
TkA06G366950	`PF14531`	Kinase-like	162	310	7.2e-07	29.5
TkA06G366950	`PF06293`	Kdo	345	369	0.00065	19.9
TkA06G366950	`PF13833`	EF-hand_8	365	393	1.4e-11	44.6
TkA06G366950	`PF12763`	EH	365	432	6e-05	23.6
TkA06G366950	`PF25825`	SAPC2_N	366	432	1.6e-05	25.4
TkA06G366950	`PF24082`	SPEF2_C	366	392	0.03	14.8
TkA06G366950	`PF21008`	AIF-1	369	432	1.4e-05	26.1
TkA06G366950	`PF00069`	Pkinase	371	413	1.2e-78	264.8
TkA06G366950	`PF25578`	EF-hand_STIM1	372	394	0.00094	19.9
TkA06G366950	`PF13499`	EF-hand_7	373	433	3.3e-25	88.9
TkA06G366950	`PF00036`	EF-hand_1	373	399	6.5e-25	85.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMP5`	Arabidopsis thaliana	sp\|Q9FMP5\|CDPKH_ARATH Calcium-dependent protein kinase 17	76.500%	Swiss-Prot	High
`Q3E9C0`	Arabidopsis thaliana	sp\|Q3E9C0\|CDPKY_ARATH Calcium-dependent protein kinase 34	77.400%	Swiss-Prot	High
`Q42479`	Arabidopsis thaliana	sp\|Q42479\|CDPK3_ARATH Calcium-dependent protein kinase 3	67.600%	Swiss-Prot	High
`Q5VQQ5`	Oryza sativa subsp. japonica	sp\|Q5VQQ5\|CDPK2_ORYSJ Calcium-dependent protein kinase 2	72.400%	Swiss-Prot	High
`B9FKW9`	Oryza sativa subsp. japonica	sp\|B9FKW9\|CDPKE_ORYSJ Calcium-dependent protein kinase 14	73.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card