LXL04_027077 | RubberDandelionOmics

Gene overview

LXL04_027077

Reference: OH-1004 Chr: Chr06 Coordinates: 8238860-8242480 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1620 bp · LXL04_027077|LXL04_027077|OH1004|cDNA

ATGGGCGGCTGTTTTAGTAAGAAGACTCGCCATACCTCAAATTCCAATGGCTATGGATCTTCTAAACAACAAAATTACCACCCAGTTAACGAAAAGCCCACCTCAAACTACACTCACGAAACCCATCATCGCCAgccgccaccgccgccgccgccacAACAAACAACACAACCACCTAACCCAGCACCACCACCTCCAAACCCTAGACCCACCCAGGCTTCCGACCCCAACACCATTCTCGGGAAGCCATTCGAGGACAT...

CDS

Download CDS FASTA

1620 bp · LXL04_027077|LXL04_027077|OH1004|CDS

ATGGGCGGCTGTTTTAGTAAGAAGACTCGCCATACCTCAAATTCCAATGGCTATGGATCTTCTAAACAACAAAATTACCACCCAGTTAACGAAAAGCCCACCTCAAACTACACTCACGAAACCCATCATCGCCAGCCGCCACCGCCGCCGCCGCCACAACAAACAACACAACCACCTAACCCAGCACCACCACCTCCAAACCCTAGACCCACCCAGGCTTCCGACCCCAACACCATTCTCGGGAAGCCATTCGAGGACAT...

Protein

Download Protein FASTA

539 aa · LXL04_027077|LXL04_027077|OH1004|PROTEIN

MGGCFSKKTRHTSNSNGYGSSKQQNYHPVNEKPTSNYTHETHHRQPPPPPPPQQTTQPPNPAPPPPNPRPTQASDPNTILGKPFEDIRRHYTLGKELGRGQFGVTYLCTETSSGHTYACKSILKRKLASKNDKEDIKREIQIMQHLSGQPNIVEFKGTYEDRQSVHLVMELCAGGELFDRIIAQGHYTEKAAATICRQIVNVVHVCHFMGVMHRDLKPENFLLSSKDENSMLKATDFGLSVFIEEGKVHRDIVGSAYYVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027077`
TK1151 ID	TkA06G366950
OH-1004 ID	LXL04_027077
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	63.400
Protein coverage (%)	TK1151 88.247 / OH-1004 82.189 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027077

Location Chr06:8238860-8242480 (+)

Description Similar to CPK21: Calcium-dependent protein kinase 21

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g04720`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At4g21940`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At3g20410`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0515100`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027077 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G20410

ath:AT4G04720

ath:AT4G21940

dosa:Os07g0515100

osa:4343373

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.477

Rank 1 · LXL04_027077 · OH-1004

Cytoplasm0.466

Rank 2 · LXL04_027077 · OH-1004

Nucleus0.208

Rank 3 · LXL04_027077 · OH-1004

Golgi apparatus0.099

Rank 4 · LXL04_027077 · OH-1004

Endoplasmic reticulum0.065

Rank 5 · LXL04_027077 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase91-349 aa

PF07714.24PK_Tyr_Ser-Thr92-345 aa

PF13499.13EF-hand_7396-457 aa

PF00036.39EF-hand_1397-423 aa

PF13405.13EF-hand_6397-425 aa

PF13202.13EF-hand_5397-419 aa

PF13833.13EF-hand_8409-456 aa

PF00036.39EF-hand_1432-456 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027077	`PF00069.32`	Pkinase	91	349	8.6e-78	262.1
LXL04_027077	`PF07714.24`	PK_Tyr_Ser-Thr	92	345	3.1e-30	106.1
LXL04_027077	`PF13499.13`	EF-hand_7	396	457	2.3e-32	111.8
LXL04_027077	`PF00036.39`	EF-hand_1	397	423	1e-32	109.9
LXL04_027077	`PF13405.13`	EF-hand_6	397	425	4.7e-25	85.6
LXL04_027077	`PF13202.13`	EF-hand_5	397	419	4.6e-22	77.1
LXL04_027077	`PF13833.13`	EF-hand_8	409	456	3e-16	59.6
LXL04_027077	`PF00036.39`	EF-hand_1	432	456	1e-32	109.9
LXL04_027077	`PF13499.13`	EF-hand_7	467	529	2.3e-32	111.8
LXL04_027077	`PF21008.4`	AIF-1	467	529	3.6e-09	37.7
LXL04_027077	`PF00036.39`	EF-hand_1	469	495	1e-32	109.9
LXL04_027077	`PF13405.13`	EF-hand_6	469	497	4.7e-25	85.6
LXL04_027077	`PF13833.13`	EF-hand_8	481	529	3e-16	59.6
LXL04_027077	`PF00036.39`	EF-hand_1	504	530	1e-32	109.9
LXL04_027077	`PF13405.13`	EF-hand_6	504	530	4.7e-25	85.6
LXL04_027077	`PF13202.13`	EF-hand_5	504	526	4.6e-22	77.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZSA2`	Arabidopsis thaliana	Calcium-dependent protein kinase 21	76.580%	Swiss-Prot	strong database homology
`O49717`	Arabidopsis thaliana	Calcium-dependent protein kinase 15	72.527%	Swiss-Prot	strong database homology
`Q38868`	Arabidopsis thaliana	Calcium-dependent protein kinase 9	72.274%	Swiss-Prot	strong database homology
`P53683`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 19	76.067%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card