TkA04G163120 | RubberDandelionOmics

Gene overview

TkA04G163120

Reference: TK1151 Chr: Chr04 Coordinates: 42127916-42130540 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1874 bp · TkA04G163120|TK1151|cDNA

GTAAATTCAGAAATTTGAAATCAAGCCGGACGCCAAATACTTTATAGAATCGGACATAACTTTTATTATATTTATTAGTTTTACGTTTGGGCCCTTGTTCCCTCTCTCCCTCTCTCGCTCTTTTTTTTGTAGAGAGAGTGGCACAAAATTTAGATATATACTTGCGATATTCATAGATTTAGGGCACGAAGATGGCGAATTAGTGTGAGGAATTGCAAAATTATCTACCGTTTAGTTTAATTTGTGCAAATAATTGTTCG...

CDS

Download CDS FASTA

1401 bp · TkA04G163120|TK1151|CDS

ATGGACGGGAGGAGGATAACGGCGAGTCCACGTCCGTGCAATGGCCGGAGGGTGGTGGCGAAGAAGCGGCCATGTGGTGGTGTTGATGGGTTTGTGAATAGCGTTAAGAAGCTTCAAAGGAGAGAGATTTGTTCAAAGCGCGATCGTTCTTTTAGTATGTGTGATGCTCAGGAAAGGTTCAGAAATATCCGCTTACAGGAGGAGTATGATACCCATGATCCAAAGGGACACTGTTCTATGGTATTACCATTTCTCAAAAA...

Protein

Download Protein FASTA

466 aa · TkA04G163120|TK1151|PROTEIN

MDGRRITASPRPCNGRRVVAKKRPCGGVDGFVNSVKKLQRREICSKRDRSFSMCDAQERFRNIRLQEEYDTHDPKGHCSMVLPFLKKRSKIVEIVAARDIVFALAQSGICAAFSRETNQRICFLNVSPDEVIRSLFYNKNNDSLITVSVYASDSFSSLKCRTTGIEYIRRGKPDAGFALFESESLKWPGFVEFDDVNGKVLTFSAQDSIYKVFDLKNYMMLYSISDKNVQEIKISPGIMLLIFNKSSGHVPLKILSIEDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G163120`
TK1151 ID	TkA04G163120
OH-1004 ID	LXL04_035149
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.200
Protein coverage (%)	TK1151 97.425 / OH-1004 39.160 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G163120`
Location	Chr04:42127916-42130540 (-)
Description	Similar to Putative AC transposase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035149` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0009791 post-embryonic development Biological Process GO:0032196 transposition Biological Process GO:0005634 nucleus Cellular Component GO:0005829 cytosol Cellular Component GO:0003677 DNA binding Molecular Function GO:0008270 zinc ion binding Molecular Function GO:0046983 protein dimerization activity Molecular Function
KEGG gene cross-reference	ath:AT3G42170 dosa:Os03g0733400 dosa:Os05g0239150 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.523

Rank 1 · TkA04G163120 · TK1151

Cytoplasm0.424

Rank 2 · TkA04G163120 · TK1151

Mitochondrion0.057

Rank 3 · TkA04G163120 · TK1151

Cell membrane0.053

Rank 4 · TkA04G163120 · TK1151

Endoplasmic reticulum0.036

Rank 5 · TkA04G163120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25463DUF789949-464 aa

PF23393Beta-prop_WDR90_POC16_2nd84-134 aa

PF21828DUF688886-105 aa

PF23756Beta-prop_HPS5115-152 aa

PF24807WD40_CDC20-Fz117-150 aa

PF23381Beta-prop_IFT122_1st128-149 aa

PF24796WDR55129-148 aa

PF25174Beta-prop_THOC3192-268 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G163120	`PF25463`	DUF7899	49	464	5.3e-224	743.8
TkA04G163120	`PF23393`	Beta-prop_WDR90_POC16_2nd	84	134	0.00014	21.9
TkA04G163120	`PF21828`	DUF6888	86	105	0.19	12.3
TkA04G163120	`PF23756`	Beta-prop_HPS5	115	152	0.062	13.2
TkA04G163120	`PF24807`	WD40_CDC20-Fz	117	150	0.0018	18.3
TkA04G163120	`PF23381`	Beta-prop_IFT122_1st	128	149	0.0051	16.9
TkA04G163120	`PF24796`	WDR55	129	148	0.0027	17.5
TkA04G163120	`PF25174`	Beta-prop_THOC3	192	268	0.00036	20.3
TkA04G163120	`PF23393`	Beta-prop_WDR90_POC16_2nd	196	265	0.00014	21.9
TkA04G163120	`PF25175`	Beta-prop_WDR5	196	308	0.0012	18.9
TkA04G163120	`PF24807`	WD40_CDC20-Fz	221	311	0.0018	18.3
TkA04G163120	`PF29037`	DSE1_N	221	329	0.016	15.1
TkA04G163120	`PF23381`	Beta-prop_IFT122_1st	222	360	0.0051	16.9
TkA04G163120	`PF24796`	WDR55	226	344	0.0027	17.5
TkA04G163120	`PF23756`	Beta-prop_HPS5	251	332	0.062	13.2
TkA04G163120	`PF23393`	Beta-prop_WDR90_POC16_2nd	260	376	0.00014	21.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card