RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G606960
Reference: TK1151 Chr: Chr03 Coordinates: 154156936-154160637 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

927 bp · TkA03G606960|TK1151|cDNA

TCAAGACATGATCAAAATGTATTCAGTTTTTATCCGGATTCGAATCCGTGTGAAGGATTTGAGGACGTATTGAAACGATATAGAGAGATAACTCCTCAACTTCGACTTTCAGGACCCACATCTTTTGCACCTATAATAGAAATGGCCACGACAATTGTTGAAGAAAGTGGTGGCCAATACCATGTTTTGTTGATTCTTGCGGATGGCCAGGTAACAAGAACTGGTGATAATGAGTTTGGTCAACTCAGTTCACAGGAACG...

CDS

Download CDS FASTA

780 bp · TkA03G606960|TK1151|CDS

TCAAGACATGATCAAAATGTATTCAGTTTTTATCCGGATTCGAATCCGTGTGAAGGATTTGAGGACGTATTGAAACGATATAGAGAGATAACTCCTCAACTTCGACTTTCAGGACCCACATCTTTTGCACCTATAATAGAAATGGCCACGACAATTGTTGAAGAAAGTGGTGGCCAATACCATGTTTTGTTGATTCTTGCGGATGGCCAGGTAACAAGAACTGGTGATAATGAGTTTGGTCAACTCAGTTCACAGGAACG...

Protein

Download Protein FASTA

259 aa · TkA03G606960|TK1151|PROTEIN

SRHDQNVFSFYPDSNPCEGFEDVLKRYREITPQLRLSGPTSFAPIIEMATTIVEESGGQYHVLLILADGQVTRTGDNEFGQLSSQERNTIDAIVKASNYPLSIILVGVGDGPWDMMEEFDDNIPSRDFDNFQFVNFTDTMSQKVDPLKKQTEFALTALMEIPSQYKTTLKLNLLGIRTGYCPNTIPLPPPYGGNLQILHPYSLTETASPSDNKMCALCLSNPKDMAFGCGHQTCCNCGLDLLSCPICQDLINTKIRLYQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G606960
TK1151 IDTkA03G606960
OH-1004 IDLXL04_011628
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)78.600
Protein coverage (%)TK1151 100.000 / OH-1004 65.010
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G606960
LocationChr03:154156936-154160637 (+)
DescriptionSimilar to RGLG1: E3 ubiquitin-protein ligase RGLG1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g01650 E3 ubiquitin-protein ligase that mediates the formation of 'Lys-63'-linked ubiquitin chains.
Ubiquitin lysine 63 chain forming ligases regulate apical dominance in Arabidopsis.2007 · DOI: 10.1105/tpc.107.052035
Arabidopsis RGLG2, functioning as a RING E3 ligase, interacts with AtERF53 and negatively regulates the plant drought stress response.2012 · DOI: 10.1104/pp.111.189738
At5g14420 E3 ubiquitin-protein ligase that mediates the formation of 'Lys-63'-linked ubiquitin chains.
Ubiquitin lysine 63 chain forming ligases regulate apical dominance in Arabidopsis.2007 · DOI: 10.1105/tpc.107.052035
Arabidopsis RGLG2, functioning as a RING E3 ligase, interacts with AtERF53 and negatively regulates the plant drought stress response.2012 · DOI: 10.1104/pp.111.189738
At1g67800 Together with RGLG1, mediates the ubiquitination and subsequent proteasomal degradation of the target protein PP2CA. No verified direct reference in this release
At5g63970 Possesses E3 ubiquitin-protein ligase in vitro.
Two novel RING-type ubiquitin ligases, RGLG3 and RGLG4, are essential for jasmonate-mediated responses in Arabidopsis.2012 · DOI: 10.1104/pp.112.203422
Hijacking of the jasmonate pathway by the mycotoxin fumonisin B1 (FB1) to initiate programmed cell death in Arabidopsis is modulated by RGLG3 and RGLG4.2015 · DOI: 10.1093/jxb/erv068
The Arabidopsis Iron-Sulfur Protein GRXS17 is a Target of the Ubiquitin E3 Ligases RGLG3 and RGLG4.2016 · DOI: 10.1093/pcp/pcw122
At1g79380 Possesses E3 ubiquitin-protein ligase in vitro.
Two novel RING-type ubiquitin ligases, RGLG3 and RGLG4, are essential for jasmonate-mediated responses in Arabidopsis.2012 · DOI: 10.1104/pp.112.203422
Hijacking of the jasmonate pathway by the mycotoxin fumonisin B1 (FB1) to initiate programmed cell death in Arabidopsis is modulated by RGLG3 and RGLG4.2015 · DOI: 10.1093/jxb/erv068
The Arabidopsis Iron-Sulfur Protein GRXS17 is a Target of the Ubiquitin E3 Ligases RGLG3 and RGLG4.2016 · DOI: 10.1093/pcp/pcw122

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_011628 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009611 response to wounding Biological Process
GO:0009690 cytokinin metabolic process Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process
GO:0009850 auxin metabolic process Biological Process
GO:0009867 jasmonic acid mediated signaling pathway Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0070534 protein K63-linked ubiquitination Biological Process
GO:0080148 negative regulation of response to water deprivation Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
KEGG gene cross-reference
ath:AT3G01650
ath:AT5G14420
ath:AT5G63970
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.488
Rank 1 · TkA03G606960 · TK1151
Nucleus0.368
Rank 2 · TkA03G606960 · TK1151
Cell membrane0.149
Rank 3 · TkA03G606960 · TK1151
Lysosome / Vacuole0.111
Rank 4 · TkA03G606960 · TK1151
Golgi apparatus0.082
Rank 5 · TkA03G606960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07002Copine3-174 aa
PF25390WD40_RLD52-86 aa
PF13540RCC1_257-81 aa
PF10138vWA-TerF-like85-139 aa
PF13920zf-C3HC4_3212-252 aa
PF13923zf-C3HC4_2214-247 aa
PF24921RING_XB3-XBAT31214-243 aa
PF13639zf-RING_2214-248 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G606960PF07002Copine31742.3e-55188.1
TkA03G606960PF25390WD40_RLD52860.0005820.0
TkA03G606960PF13540RCC1_257810.01116.2
TkA03G606960PF10138vWA-TerF-like851390.000421.4
TkA03G606960PF13920zf-C3HC4_32122525.6e-0626.8
TkA03G606960PF13923zf-C3HC4_22142470.01415.9
TkA03G606960PF24921RING_XB3-XBAT312142431.99.3
TkA03G606960PF13639zf-RING_22142484.78.3
TkA03G606960PF00097zf-C3HC42152470.002218.5
TkA03G606960PF14447Prok-RING_42152540.511.0
TkA03G606960PF25390WD40_RLD2242390.0005820.0
TkA03G606960PF13540RCC1_22272330.01116.2
TkA03G606960PF24921RING_XB3-XBAT312432511.99.3
TkA03G606960PF13639zf-RING_22432524.78.3
TkA03G606960PF00097zf-C3HC42442540.002218.5
TkA03G606960PF13923zf-C3HC4_22442540.01415.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SS90Arabidopsis thalianasp|Q9SS90|RGLG1_ARATH E3 ubiquitin-protein ligase RGLG163.100%Swiss-ProtHigh
Q9LY87Arabidopsis thalianasp|Q9LY87|RGLG2_ARATH E3 ubiquitin-protein ligase RGLG261.300%Swiss-ProtHigh
Q8LB88Arabidopsis thalianasp|Q8LB88|RGLG5_ARATH E3 ubiquitin-protein ligase RGLG560.900%Swiss-ProtHigh
Q8RX26Arabidopsis thalianasp|Q8RX26|RGLG3_ARATH E3 ubiquitin-protein ligase RGLG356.600%Swiss-ProtHigh
Q9SAL0Arabidopsis thalianasp|Q9SAL0|RGLG4_ARATH E3 ubiquitin-protein ligase RGLG453.900%Swiss-ProtHigh

JBrowse

View in Genome Browser