LXL04_011628 | RubberDandelionOmics

Gene overview

LXL04_011628

Reference: OH-1004 Chr: Chr02 Coordinates: 168536258-168540958 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1512 bp · LXL04_011628|LXL04_011628|OH1004|cDNA

ATGGCAGAGAAAGAAGATTGTCGGTGGCACGATTATGGACGACAACAATTTCTGGAGGCGAGCAGAGATGGACGGCAACAAAAGCGAGAGGAGGATGAAGGAACCGGTAGAGAGGAGAAAGTAAAAATGGGAAACAAGAATTCAAGAGAAACATCACCAAGTATAAGAACAGATTCCGGTCATCCACCTTCAACTAGTGCTACTTACATACCAATGCATCATCATGCACCACTACCGGCTGAAAAAAGATTGGACAGAAG...

CDS

Download CDS FASTA

1512 bp · LXL04_011628|LXL04_011628|OH1004|CDS

ATGGCAGAGAAAGAAGATTGTCGGTGGCACGATTATGGACGACAACAATTTCTGGAGGCGAGCAGAGATGGACGGCAACAAAAGCGAGAGGAGGATGAAGGAACCGGTAGAGAGGAGAAAGTAAAAATGGGAAACAAGAATTCAAGAGAAACATCACCAAGTATAAGAACAGATTCCGGTCATCCACCTTCAACTAGTGCTACTTACATACCAATGCATCATCATGCACCACTACCGGCTGAAAAAAGATTGGACAGAAG...

Protein

Download Protein FASTA

503 aa · LXL04_011628|LXL04_011628|OH1004|PROTEIN

MAEKEDCRWHDYGRQQFLEASRDGRQQKREEDEGTGREEKVKMGNKNSRETSPSIRTDSGHPPSTSATYIPMHHHAPLPAEKRLDRRYSRIADDYETLDQVTMALAEAGLESSNLIVGIDFTKSNEWSGTKSFNKRSLHDIGVVQNPYEQAISIIGKTLSSFDEDNLIPCFGFGDASRHDQNVFSFYPDSNPCEGFEDVLKRYREITPQLRLSGPTSFAPIIEMATTIVEESGGQYHVLLILADGQVTRTGDNEFGQLSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011628`
TK1151 ID	TkA03G606960
OH-1004 ID	LXL04_011628
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	78.600
Protein coverage (%)	TK1151 100.000 / OH-1004 65.010 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011628

Location Chr02:168536258-168540958 (+)

Description Similar to RGLG1: E3 ubiquitin-protein ligase RGLG1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01650`	E3 ubiquitin-protein ligase that mediates the formation of 'Lys-63'-linked ubiquitin chains.	Ubiquitin lysine 63 chain forming ligases regulate apical dominance in Arabidopsis.2007 · DOI: 10.1105/tpc.107.052035 Arabidopsis RGLG2, functioning as a RING E3 ligase, interacts with AtERF53 and negatively regulates the plant drought stress response.2012 · DOI: 10.1104/pp.111.189738
`At5g14420`	E3 ubiquitin-protein ligase that mediates the formation of 'Lys-63'-linked ubiquitin chains.	Ubiquitin lysine 63 chain forming ligases regulate apical dominance in Arabidopsis.2007 · DOI: 10.1105/tpc.107.052035 Arabidopsis RGLG2, functioning as a RING E3 ligase, interacts with AtERF53 and negatively regulates the plant drought stress response.2012 · DOI: 10.1104/pp.111.189738
`At5g63970`	Possesses E3 ubiquitin-protein ligase in vitro.	Two novel RING-type ubiquitin ligases, RGLG3 and RGLG4, are essential for jasmonate-mediated responses in Arabidopsis.2012 · DOI: 10.1104/pp.112.203422 Hijacking of the jasmonate pathway by the mycotoxin fumonisin B1 (FB1) to initiate programmed cell death in Arabidopsis is modulated by RGLG3 and RGLG4.2015 · DOI: 10.1093/jxb/erv068 The Arabidopsis Iron-Sulfur Protein GRXS17 is a Target of the Ubiquitin E3 Ligases RGLG3 and RGLG4.2016 · DOI: 10.1093/pcp/pcw122
`At1g67800`	Together with RGLG1, mediates the ubiquitination and subsequent proteasomal degradation of the target protein PP2CA.	No verified direct reference in this release
`At1g79380`	Possesses E3 ubiquitin-protein ligase in vitro.	Two novel RING-type ubiquitin ligases, RGLG3 and RGLG4, are essential for jasmonate-mediated responses in Arabidopsis.2012 · DOI: 10.1104/pp.112.203422 Hijacking of the jasmonate pathway by the mycotoxin fumonisin B1 (FB1) to initiate programmed cell death in Arabidopsis is modulated by RGLG3 and RGLG4.2015 · DOI: 10.1093/jxb/erv068 The Arabidopsis Iron-Sulfur Protein GRXS17 is a Target of the Ubiquitin E3 Ligases RGLG3 and RGLG4.2016 · DOI: 10.1093/pcp/pcw122

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011628 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009611 response to wounding Biological Process

GO:0009690 cytokinin metabolic process Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009850 auxin metabolic process Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0070534 protein K63-linked ubiquitination Biological Process

GO:0080148 negative regulation of response to water deprivation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G01650

ath:AT5G14420

ath:AT5G63970

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.428

Rank 1 · LXL04_011628 · OH-1004

Nucleus0.353

Rank 2 · LXL04_011628 · OH-1004

Cell membrane0.173

Rank 3 · LXL04_011628 · OH-1004

Mitochondrion0.102

Rank 4 · LXL04_011628 · OH-1004

Endoplasmic reticulum0.093

Rank 5 · LXL04_011628 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07002.23Copine137-316 aa

PF07002.23Copine374-418 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011628	`PF07002.23`	Copine	137	316	4.5e-66	223.2
LXL04_011628	`PF07002.23`	Copine	374	418	4.5e-66	223.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SS90`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RGLG1	65.414%	Swiss-Prot	moderate database homology
`Q9LY87`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RGLG2	73.799%	Swiss-Prot	weak database homology
`Q8RX26`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RGLG3	47.129%	Swiss-Prot	moderate database homology
`Q8LB88`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RGLG5	73.684%	Swiss-Prot	weak database homology
`Q9SAL0`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RGLG4	54.317%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card