TkA02G473570 | RubberDandelionOmics

Gene overview

TkA02G473570

Reference: TK1151 Chr: Chr02 Coordinates: 120841415-120844359 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1087 bp · TkA02G473570|TK1151|cDNA

ATTATGCAGACTGTGCTTACTAGGTATAATACACTTACTGGAGTTATGTATAAGGATGATCCAACAATCATGGCTTGGGAGCTCATGAATGAGCCTAGATGCACTTCTGATACATCAGGAAGAACAATTCAGGCATGGATTACAGAAATGGCTGCACATGTGAAATCGATCGATCGAAAACACTTGCTGGAAGCAGGTCTCGAGGGCTTCTACGGCAGACCCAATTCTCAGAATCCTGGTTTCGACGTCGGCACTGATTT...

CDS

Download CDS FASTA

1314 bp · TkA02G473570|TK1151|CDS

ATGGCGAAAAAATCCGCATTATCGATCTTTCTCGTTGCTCTTCTGCTCCAAAACCTCAACACTTTTCTTGAAACCGAAGCCGCAGGATCGAAAAATGGTGGTAGTTTCATAACAACAAGAGGAGTCCATTTCATGTTAAATGGTAGCCCTTATTATGCCAATGGCTTTAATGCCTACTGGTTGATGATTTTAGCCTCCGATCCTTCACAAAGATCCAAAGTTTCCGATGCTTTTCATCAGGCTTCTTCACATGGCCTTTC...

Protein

Download Protein FASTA

437 aa · TkA02G473570|TK1151|PROTEIN

MAKKSALSIFLVALLLQNLNTFLETEAAGSKNGGSFITTRGVHFMLNGSPYYANGFNAYWLMILASDPSQRSKVSDAFHQASSHGLSVARTWAFSDGGVTPLQYSPGSYNEQMFKGLDFVVAEARRFGIKLVLSLVNNYESLGGKKQYVNWARNQGQYVTSDDDFFRNPVAKGFYKNHVKTVLTRYNTLTGVMYKDDPTIMAWELMNEPRCTSDTSGRTIQAWITEMAAHVKSIDRKHLLEAGLEGFYGRPNSQNPGFDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G473570`
TK1151 ID	TkA02G473570
OH-1004 ID	LXL04_007715
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	55.300
Protein coverage (%)	TK1151 88.101 / OH-1004 82.553 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G473570

Location Chr02:120841415-120844359 (-)

Description Similar to MAN5: Mannan endo-1,4-beta-mannosidase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g66460`	Required for both, loosening of the micropylar endosperm, and rupture of the seed coat in germinating seeds.	Arabidopsis thaliana bZIP44: a transcription factor affecting seed germination and expression of the mannanase-encoding gene AtMAN7.2013 · DOI: 10.1111/tpj.12162
`At3g10890`	Mannan endo-1,4-beta-mannosidase 3.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0663300`	Mannan endo-1,4-beta-mannosidase 1.	No verified direct reference in this release
`Os02g0766900`	Putative mannan endo-1,4-beta-mannosidase 9.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007715 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0016985 mannan endo-1,4-beta-mannosidase activity Molecular Function

KEGG gene cross-reference

dosa:Os01g0663300

sly:544170

sly:544199

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.730

Rank 1 · TkA02G473570 · TK1151

Cytoplasm0.081

Rank 2 · TkA02G473570 · TK1151

Lysosome / Vacuole0.072

Rank 3 · TkA02G473570 · TK1151

Cell membrane0.047

Rank 4 · TkA02G473570 · TK1151

Endoplasmic reticulum0.040

Rank 5 · TkA02G473570 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26410GH5_mannosidase35-364 aa

PF01353GFP73-113 aa

PF00150Cellulase76-343 aa

PF02449Glyco_hydro_42107-234 aa

PF01353GFP187-215 aa

PF02449Glyco_hydro_42272-307 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G473570	`PF26410`	GH5_mannosidase	35	364	3.7e-58	198.0
TkA02G473570	`PF01353`	GFP	73	113	0.13	12.6
TkA02G473570	`PF00150`	Cellulase	76	343	4.4e-11	43.5
TkA02G473570	`PF02449`	Glyco_hydro_42	107	234	0.06	13.4
TkA02G473570	`PF01353`	GFP	187	215	0.13	12.6
TkA02G473570	`PF02449`	Glyco_hydro_42	272	307	0.06	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJZ3`	Arabidopsis thaliana	sp\|Q9FJZ3\|MAN7_ARATH Mannan endo-1,4-beta-mannosidase 7	66.400%	Swiss-Prot	High
`Q9SG94`	Arabidopsis thaliana	sp\|Q9SG94\|MAN3_ARATH Mannan endo-1,4-beta-mannosidase 3	51.900%	Swiss-Prot	High
`Q0JKM9`	Oryza sativa subsp. japonica	sp\|Q0JKM9\|MAN1_ORYSJ Mannan endo-1,4-beta-mannosidase 1	65.900%	Swiss-Prot	High
`Q6Z310`	Oryza sativa subsp. japonica	sp\|Q6Z310\|MAN9_ORYSJ Putative mannan endo-1,4-beta-mannosidase 9	57.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card