TkA02G038940 | RubberDandelionOmics

Gene overview

TkA02G038940

Reference: TK1151 Chr: Chr02 Coordinates: 9835007-9836588 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1422 bp · TkA02G038940|TK1151|cDNA

ATGTCGTTCTCATCTCTTCTCTCTAGTCGCCGATCACCTTCAGGGATGTTTAAGGTACAACAAACTGTTGGTAGTGTTCTTTGTTGCATATGTAGCAGTCCAATGACTCCAAATGCTGCCAATATGTGCGCCACGTGTCTCCGTTCTAAGGTCGACATTACAGAACGTTTACAAAACCACATCACTATCGTTCACTGCCCTGAATGCGAATCTTACTTACAGCCACCAAGAACATGGATCAAAACCCAGTTAGAATCCAA...

CDS

Download CDS FASTA

1422 bp · TkA02G038940|TK1151|CDS

ATGTCGTTCTCATCTCTTCTCTCTAGTCGCCGATCACCTTCAGGGATGTTTAAGGTACAACAAACTGTTGGTAGTGTTCTTTGTTGCATATGTAGCAGTCCAATGACTCCAAATGCTGCCAATATGTGCGCCACGTGTCTCCGTTCTAAGGTCGACATTACAGAACGTTTACAAAACCACATCACTATCGTTCACTGCCCTGAATGCGAATCTTACTTACAGCCACCAAGAACATGGATCAAAACCCAGTTAGAATCCAA...

Protein

Download Protein FASTA

473 aa · TkA02G038940|TK1151|PROTEIN

MSFSSLLSSRRSPSGMFKVQQTVGSVLCCICSSPMTPNAANMCATCLRSKVDITERLQNHITIVHCPECESYLQPPRTWIKTQLESKQLLTFCLKRLTSLNELRLTHAEFVWTEPHSKRIKVRLKVQKEVLNGVVLEQTHVVNYTVHDRICQSCSRVHAKPDQWVAVVQLRQQVAHRRTFFYLEQLILKHDAALKAIRIKQINHGIDFFFANRSHAGKFVSFVEKVVPVKRRHDKKLVSHDTKSNKSNYKYTFSVEICPI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G038940`
TK1151 ID	TkA02G038940
OH-1004 ID	LXL04_017489
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	75.800
Protein coverage (%)	TK1151 93.446 / OH-1004 50.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G038940`
Location	Chr02:9835007-9836588 (+)
Description	Similar to NMD3: 60S ribosomal export protein NMD3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_017489` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000055 ribosomal large subunit export from nucleus Biological Process GO:0015031 protein transport Biological Process GO:1902680 positive regulation of RNA biosynthetic process Biological Process GO:1904751 positive regulation of protein localization to nucleolus Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0016020 membrane Cellular Component GO:0003723 RNA binding Molecular Function GO:0030674 protein-macromolecule adaptor activity Molecular Function GO:0043023 ribosomal large subunit binding Molecular Function
KEGG gene cross-reference	bta:509871 hsa:51068 pon:100174372 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.921

Rank 1 · TkA02G038940 · TK1151

Cytoplasm0.154

Rank 2 · TkA02G038940 · TK1151

Cell membrane0.015

Rank 3 · TkA02G038940 · TK1151

Mitochondrion0.015

Rank 4 · TkA02G038940 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA02G038940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24921RING_XB3-XBAT3127-71 aa

PF29994NMD3_N28-158 aa

PF22910EDR4-like_1st62-74 aa

PF04981NMD3163-257 aa

PF21192OB_NMD3207-220 aa

PF29994NMD3_N233-262 aa

PF24921RING_XB3-XBAT31237-266 aa

PF22910EDR4-like_1st258-279 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G038940	`PF24921`	RING_XB3-XBAT31	27	71	0.68	10.7
TkA02G038940	`PF29994`	NMD3_N	28	158	8.5e-31	107.9
TkA02G038940	`PF22910`	EDR4-like_1st	62	74	0.49	10.7
TkA02G038940	`PF04981`	NMD3	163	257	4.8e-32	111.1
TkA02G038940	`PF21192`	OB_NMD3	207	220	4.2e-31	107.8
TkA02G038940	`PF29994`	NMD3_N	233	262	8.5e-31	107.9
TkA02G038940	`PF24921`	RING_XB3-XBAT31	237	266	0.68	10.7
TkA02G038940	`PF22910`	EDR4-like_1st	258	279	0.49	10.7
TkA02G038940	`PF21193`	NMD_SH3	260	299	7.2e-05	23.6
TkA02G038940	`PF21192`	OB_NMD3	318	406	4.2e-31	107.8
TkA02G038940	`PF22910`	EDR4-like_1st	393	396	0.49	10.7
TkA02G038940	`PF29994`	NMD3_N	403	423	8.5e-31	107.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card