LXL04_031978 | RubberDandelionOmics

Gene overview

LXL04_031978

Reference: OH-1004 Chr: Chr07 Coordinates: 14176532-14178913 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1779 bp · LXL04_031978|LXL04_031978|OH1004|cDNA

ATGGGGGCTCACGCTGAACCCCATCTGGCCATTTCTATACTCCTCCACGTCCAGATGTCTGTTAATTTCAATATCAGCCTCTTCCCTTTTACCATTACCATAAAAGCTTTTCAATTTCCACCCACAAAAGATCCAAACCCTTATAATAAAACGGGTCAAATTAAAGGATCTCTTTCAAAGACCCTTCAATCATTACCATATGCGTTTCAGAAATATCTTCACAAATTACACAAAAAACTCGTGCATATTCGCCTAGATCT...

CDS

Download CDS FASTA

1779 bp · LXL04_031978|LXL04_031978|OH1004|CDS

ATGGGGGCTCACGCTGAACCCCATCTGGCCATTTCTATACTCCTCCACGTCCAGATGTCTGTTAATTTCAATATCAGCCTCTTCCCTTTTACCATTACCATAAAAGCTTTTCAATTTCCACCCACAAAAGATCCAAACCCTTATAATAAAACGGGTCAAATTAAAGGATCTCTTTCAAAGACCCTTCAATCATTACCATATGCGTTTCAGAAATATCTTCACAAATTACACAAAAAACTCGTGCATATTCGCCTAGATCT...

Protein

Download Protein FASTA

592 aa · LXL04_031978|LXL04_031978|OH1004|PROTEIN

MGAHAEPHLAISILLHVQMSVNFNISLFPFTITIKAFQFPPTKDPNPYNKTGQIKGSLSKTLQSLPYAFQKYLHKLHKKLVHIRLDLFTSSRIRYVLRQLTIRLTYDVAGDRAFEGPPPAGWIRYSGEETGSALGETKEERESRIRSLFNFFDSSNAGYLDSAHIEVGLSALQIPADYKYAKELIRVCDANKDGTVDYQEFKRYMDDKELELYRIFQAIDVEHSGCILPEELYDALAKAGIELDDEELASFVERVDKDNN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031978`
TK1151 ID	TkA08G139600
OH-1004 ID	LXL04_031978
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	97.600
Protein coverage (%)	TK1151 72.887 / OH-1004 34.966 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031978

Location Chr07:14176532-14178913 (+)

Description Similar to APC2: Calcium-dependent mitochondrial ATP-magnesium/phosphate carrier protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51050`	Calcium-dependent mitochondrial carrier protein that catalyzes the import of ATP co-transported with metal divalent cations across the mitochondrial inner membrane in exchange for phosphate (Pi).	No verified direct reference in this release
`At5g07320`	Calcium-dependent mitochondrial carrier protein that catalyzes the import of ATP co-transported with metal divalent cations across the mitochondrial inner membrane in exchange for phosphate (Pi).	No verified direct reference in this release
`At5g61810`	Calcium-dependent mitochondrial carrier protein that catalyzes the import of ATP co-transported with metal divalent cations across the mitochondrial inner membrane in exchange for phosphate (Pi).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031978 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006839 mitochondrial transport Biological Process

GO:0015866 ADP transport Biological Process

GO:0015867 ATP transport Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0035435 phosphate ion transmembrane transport Biological Process

GO:0051503 adenine nucleotide transport Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:0071277 cellular response to calcium ion Biological Process

GO:0080121 AMP transport Biological Process

GO:1990544 mitochondrial ATP transmembrane transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

KEGG gene cross-reference

ath:AT5G07320

ath:AT5G51050

ath:AT5G61810

mmu:229731

xtr:496462

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.588

Rank 1 · LXL04_031978 · OH-1004

Plastid0.258

Rank 2 · LXL04_031978 · OH-1004

Cytoplasm0.065

Rank 3 · LXL04_031978 · OH-1004

Peroxisome0.040

Rank 4 · LXL04_031978 · OH-1004

Endoplasmic reticulum0.039

Rank 5 · LXL04_031978 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13499.13EF-hand_7142-205 aa

PF00036.39EF-hand_1182-205 aa

PF13499.13EF-hand_7211-267 aa

PF13833.13EF-hand_8224-272 aa

PF00036.39EF-hand_1252-272 aa

PF00153.33Mito_carr310-395 aa

PF00153.33Mito_carr405-490 aa

PF00153.33Mito_carr501-589 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031978	`PF13499.13`	EF-hand_7	142	205	8.3e-21	74.8
LXL04_031978	`PF00036.39`	EF-hand_1	182	205	1.1e-18	66.0
LXL04_031978	`PF13499.13`	EF-hand_7	211	267	8.3e-21	74.8
LXL04_031978	`PF13833.13`	EF-hand_8	224	272	3e-08	34.0
LXL04_031978	`PF00036.39`	EF-hand_1	252	272	1.1e-18	66.0
LXL04_031978	`PF00153.33`	Mito_carr	310	395	1.4e-78	259.4
LXL04_031978	`PF00153.33`	Mito_carr	405	490	1.4e-78	259.4
LXL04_031978	`PF00153.33`	Mito_carr	501	589	1.4e-78	259.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FI43`	Arabidopsis thaliana	Calcium-dependent mitochondrial ATP-magnesium/phosphate carrier protein 2	75.162%	Swiss-Prot	strong database homology
`Q9LY28`	Arabidopsis thaliana	Calcium-dependent mitochondrial ATP-magnesium/phosphate carrier protein 3	72.985%	Swiss-Prot	strong database homology
`Q9FLS8`	Arabidopsis thaliana	Calcium-dependent mitochondrial ATP-magnesium/phosphate carrier protein 1	68.043%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card