TkA08G139600 | RubberDandelionOmics

Gene overview

TkA08G139600

Reference: TK1151 Chr: Chr08 Coordinates: 36298152-36300839 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2111 bp · TkA08G139600|TK1151|cDNA

GGAACATTGGTCAAACCATGGGGGCTCACGCTGAACCCCATCTGGCCATTTCTATACTCCTCCACGTCCAGATGTCTGTTAATTTCAATATCAGCCTCTTCCCTTTTACCATTACCATAAAAGCTTTTCAATTTCCACCCACAAAAGATCCAAACCCTTATAATAAAACGGGTCAAATTAAAGGATCTCTTTCAAAGACCCTTCAATCATTACCATATGCGTTTCAGAAATATCTTCACAAATTACACAAAAACTCGTGC...

CDS

Download CDS FASTA

855 bp · TkA08G139600|TK1151|CDS

ATGACGTCGCCGGCGATCGAGCATTCGAAGGACCACCACCGGCCGGCTGGATTCGGTACTCCGGTGAAGAAACCGGGAGCGGTGTCCATGGACCATGTTTTATCAGCATTGGGGGAAACCAAAGAGGAACGAGAATCGCGAATTCGGAGTTTGTTTAATTTCTTCGATTCATCAAATGCAGGGTATTTGGATTCCGCTCATATCGAGGTAGGGTTATCAGCGTTGCAAATTCCAGCGGATTACAAGTACGCGAAGGAATT...

Protein

Download Protein FASTA

284 aa · TkA08G139600|TK1151|PROTEIN

MTSPAIEHSKDHHRPAGFGTPVKKPGAVSMDHVLSALGETKEERESRIRSLFNFFDSSNAGYLDSAHIEVGLSALQIPADYKYAKELIRVCDANKDGTVDYQEFKRYMDDKELELYRIFQAIDVEHSGCILPEELYDALAKAGIELDDEELASFVERVDKDNNGIITFEEWRDFLLLYPHEATIENIYQYWERVSLVDIGEQAVIPTGISKHVHASKYLIAGGVAGAASRTATAPSTASKSSSKSKPPKPPSPQQSNPSG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G139600`
TK1151 ID	TkA08G139600
OH-1004 ID	LXL04_031978
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	97.600
Protein coverage (%)	TK1151 72.887 / OH-1004 34.966 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G139600

Location Chr08:36298152-36300839 (+)

Description Similar to APC2: Calcium-dependent mitochondrial ATP-magnesium/phosphate carrier protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51050`	Calcium-dependent mitochondrial carrier protein that catalyzes the import of ATP co-transported with metal divalent cations across the mitochondrial inner membrane in exchange for phosphate (Pi).	No verified direct reference in this release
`At5g07320`	Calcium-dependent mitochondrial carrier protein that catalyzes the import of ATP co-transported with metal divalent cations across the mitochondrial inner membrane in exchange for phosphate (Pi).	No verified direct reference in this release
`At5g61810`	Calcium-dependent mitochondrial carrier protein that catalyzes the import of ATP co-transported with metal divalent cations across the mitochondrial inner membrane in exchange for phosphate (Pi).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031978 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006839 mitochondrial transport Biological Process

GO:0015866 ADP transport Biological Process

GO:0015867 ATP transport Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0035435 phosphate ion transmembrane transport Biological Process

GO:0051503 adenine nucleotide transport Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:0071277 cellular response to calcium ion Biological Process

GO:0080121 AMP transport Biological Process

GO:1990544 mitochondrial ATP transmembrane transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

KEGG gene cross-reference

ath:AT5G07320

ath:AT5G51050

ath:AT5G61810

mmu:229731

xtr:496462

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.280

Rank 1 · TkA08G139600 · TK1151

Plastid0.248

Rank 2 · TkA08G139600 · TK1151

Mitochondrion0.191

Rank 3 · TkA08G139600 · TK1151

Nucleus0.139

Rank 4 · TkA08G139600 · TK1151

Cell membrane0.112

Rank 5 · TkA08G139600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09275Pertus-S4-tox7-37 aa

PF14658EF-hand_923-59 aa

PF10591SPARC_Ca_bdg38-105 aa

PF22592FCaBP_EF-hand39-79 aa

PF23564EF-hand_FSTL140-66 aa

PF13499EF-hand_745-108 aa

PF13833EF-hand_845-64 aa

PF13405EF-hand_647-73 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G139600	`PF09275`	Pertus-S4-tox	7	37	0.31	12.0
TkA08G139600	`PF14658`	EF-hand_9	23	59	0.0062	17.7
TkA08G139600	`PF10591`	SPARC_Ca_bdg	38	105	0.00023	22.2
TkA08G139600	`PF22592`	FCaBP_EF-hand	39	79	0.092	13.8
TkA08G139600	`PF23564`	EF-hand_FSTL1	40	66	0.0034	18.5
TkA08G139600	`PF13499`	EF-hand_7	45	108	1.2e-21	77.5
TkA08G139600	`PF13833`	EF-hand_8	45	64	1.7e-09	38.0
TkA08G139600	`PF13405`	EF-hand_6	47	73	1.6e-19	68.4
TkA08G139600	`PF25825`	SAPC2_N	47	69	0.098	13.3
TkA08G139600	`PF00036`	EF-hand_1	48	66	4.3e-20	70.4
TkA08G139600	`PF13202`	EF-hand_5	48	57	3.6e-10	39.5
TkA08G139600	`PF12763`	EH	48	67	0.001	19.7
TkA08G139600	`PF24548`	EF_EFCAB10_C	48	73	0.018	15.4
TkA08G139600	`PF14788`	EF-hand_10	49	70	8.8e-05	23.2
TkA08G139600	`PF12763`	EH	50	105	0.001	19.7
TkA08G139600	`PF30624`	EF_SSP120	50	104	0.0032	18.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FI43`	Arabidopsis thaliana	sp\|Q9FI43\|MAPC2_ARATH Calcium-dependent mitochondrial ATP-magnesium/phosphate carrier protein 2	80.000%	Swiss-Prot	High
`Q9LY28`	Arabidopsis thaliana	sp\|Q9LY28\|MAPC3_ARATH Calcium-dependent mitochondrial ATP-magnesium/phosphate carrier protein 3	73.000%	Swiss-Prot	High
`Q9FLS8`	Arabidopsis thaliana	sp\|Q9FLS8\|MAPC1_ARATH Calcium-dependent mitochondrial ATP-magnesium/phosphate carrier protein 1	70.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card